Research ArticleNeuronal Plasticity

Dynamic DNA methylation regulates neuronal intrinsic membrane excitability

See allHide authors and affiliations

Sci. Signal.  23 Aug 2016:
Vol. 9, Issue 442, pp. ra83
DOI: 10.1126/scisignal.aaf5642

Figures

  • Fig. 1 Pharmacological DNMTi increases the membrane excitability of cortical pyramidal neurons.

    (A) Input resistances (top) and resting membrane potentials (RMP; bottom) of pyramidal neurons after 24-hour vehicle control [CTL; dimethyl sulfoxide (DMSO)] and RG108 treatment. *P < 0.05, Student’s unpaired t test. (B) Representative recordings of control and RG108-treated neuronal membrane voltage responses to 500-ms-long intracellular current injections over a range of current intensities. (C) Mean AP firing rates evoked over a range of current intensities. Iinj, current injections. *P < 0.05, two-way repeated-measures analysis of variance (RM-ANOVA). (A and C) Graphs show individual cells as well as means ± SEM or means ± SEM from cells pooled from at least three experiments for each condition (CTL, n = 16 cells; RG108, n = 16 cells).

  • Fig. 2 DNMTi-enhanced excitability requires neuronal activity and NMDA receptor activity.

    (A) Representative recordings of voltage responses from pyramidal neurons after a 24-hour exposure to CTL, RG108 + APV, RG108 + NBQX + APV, or RG108 + TTX. (B) Mean AP firing rates evoked over a range of current intensities. Graph shows means ± SEM from cells pooled from at least three experiments for each condition (CTL, n = 7 cells; RG108 + APV, n = 5 cells; RG108 + NBQX + APV, n = 7 cells; RG108 + TTX, n = 7 cells).

  • Fig. 3 Gene expression and DNA demethylation mediated by TET1 are necessary for DNMTi-enhanced excitability.

    (A) Representative recordings of voltage responses from pyramidal neurons after 24-hour exposure to CTL or RG108 + actinomycin D. (B) Mean AP firing rates evoked from increasing current injections. Graph shows means ± SEM from cells pooled from at least three experiments for each condition (CTL, n = 11 cells; RG108 + actinomycin D, n = 4 cells). (C) Relative expression versus scrambled control of Tet1, Tet2, and Tet3 mRNA after treatment with a Tet1-targeting ASO. Data are normalized to the abundance in the scrambled control and are means ± SEM from three experiments (ScrCTL, n = 12 biological replicates; Tet1 ASO, n = 9 biological replicates). *P < 0.05, Mann-Whitney test. (D) Representative evoked membrane voltage responses of cells exposed to scrambled control ASO or Tet1 ASO + 24-hour RG108. (E) Mean AP firing rates evoked with 500-ms current pulses of increasing intensity. Bar graph shows means ± SEM from cells pooled from at least three experiments for each condition (scrambled control, n = 6 cells; Tet1 ASO + RG108, n = 7 cells).

  • Fig. 4 Altered DNA methylation status from shRNA-mediated TET3 knockdown regulates the expression of genes associated with ion channel activity.

    (A) Gene ontology analysis of differentially down-regulated genes in control versus TET3 knockdown neurons. (B) Heatmap showing the relative expression of all voltage and Ca2+-activated K+ channels in TET3 knockdown neurons. (C) Heatmap showing the relative expression of all voltage-gated Na+ channels in TET3 knockdown neurons. (D) Heatmap showing the relative expression of all voltage- and ligand-gated Ca2+ channels in TET3 knockdown neurons. (A to D) Data are based on RNA-seq analyses of hippocampal neurons expressing an shRNA against Tet3 (sh-Tet3) compared to those expressing a control shRNA (n = 3 samples each; GSE67245). Asterisks indicate genes that exhibited significant differential expression in TET3 knockdown neurons [false discovery rate (FDR) < 0.05].

  • Fig. 5 DNMTi alters specific components of the AP waveform.

    (A) Representative recordings of single APs elicited with a 30-ms current pulse after 24-hour CTL or RG108 (red) treatment. Inset: Overlay of recordings at an expanded time scale demonstrates the measurement of amplitude and one-half width. (B) AP amplitudes (left) and one-half widths (right) from cortical pyramidal neurons treated with RG108. (C) Examples of rates of change (insets) calculated from recordings in (A) and associations of amplitude versus maximal depolarization rate and one-half width versus maximal repolarization rate. (D) Phase plane plots (dV/dt versus membrane voltage) constructed from example records from (A). (E) Representative recordings at an expanded scale and voltage thresholds (left) and graph of all threshold measurements (right). (F) Representative recordings demonstrate the AHP components measured in pyramidal cells [upper trace at two scales; lower graphs show fast AHP (fAHP) amplitudes, mAHP amplitudes, and time-to-peak AHP measured from CTL and RG108-treated cortical neurons]. Graphs of grouped data show individual cells as well as means ± SEM from cells pooled from at least three experiments for each condition (CTL, n = 10 cells; RG108, n = 13 cells). *P < 0.05, Student’s unpaired t test.

  • Fig. 6 DNMT1 or DNMT3A knockdown increases excitability, decreases the mAHP, and decreases expression of SK channel–encoding genes.

    Neurons were exposed to scrambled control, Dnmt1 ASO, or Dnmt3a ASO. (A) Relative Dnmt1 and Dnmt3a mRNA expression after ASO exposure (scrambled control, n = 9 biological replicates; Dnmt1 ASO, n = 9 biological replicates; Dnmt3a ASO, n = 9 biological replicates). (B and C) Representative immunoblot (B) and relative DNMT1 and DNMT3A protein abundance (C) after ASO exposure (scrambled control, n = 9 biological replicates; Dnmt1 ASO, n = 9 biological replicates; Dnmt3a ASO, n = 8 biological replicates). (D and E) Representative recordings of evoked firing responses (D) and mean firing rates (E) of ASO-treated neurons (scrambled control, n = 12 cells; Dnmt1 ASO, n = 9 cells; Dnmt3a ASO, n = 7 cells). (F) Representative recordings of single APs from ASO-treated pyramidal neurons overlaid to show the mAHP. (G) Graph of mAHP amplitudes after ASO exposure (scrambled control, n = 9 cells; Dnmt1 ASO, n = 5 cells; Dnmt3a ASO, n = 5 cells). (H) Relative transcript expression of the SK channel genes Kcnn1, Kcnn2, and Kcnn3 after ASO exposure (scrambled control, n = 9 biological replicates; Dnmt1 ASO, n = 9 biological replicates; Dnmt3a ASO, n = 9 biological replicates). (A, C, and H) Data are normalized to scrambled control and are means ± SEM from three experiments. (E and G) Graphs show means ± SEM from cells pooled from at least three experiments for each condition. (A, C, G, and H) *P < 0.05, one-way ANOVA followed by Dunnett’s test. (E) *P < 0.05, RM-ANOVA.

  • Fig. 7 Bath application of the SK channel blocker apamin is ineffective after DNMTi.

    (A) Representative recordings of single APs from pyramidal neurons exposed to 24-hour CTL or 24-hour CTL + bath application of apamin, overlaid to show the mAHP amplitude relative to −70 mV. (B) Graph of mAHP amplitudes after CTL or CTL + apamin (CTL, n = 8 cells; CTL + apamin, n = 5 cells). *P < 0.05, Student’s t test. (C and D) Representative evoked voltage responses (C) and mean firing rates (D) of neurons after CTL or CTL + apamin (CTL, n = 18 cells; CTL + apamin, n = 5 cells). *P < 0.05, RM-ANOVA. (E) Representative recordings of single APs from neurons exposed to 24-hour RG108 or 24-hour RG108 + bath application of apamin. Scale is the same as in (A). (F) Graph of mAHP amplitudes after RG108 or RG108 + apamin (RG108, n = 10 cells; RG108 + apamin, n = 4 cells). (G and H) Representative evoked voltage responses (G) and mean firing rates (H) of neurons after RG108 or RG108 + apamin (RG108, n = 19 cells; RG108 + apamin, n = 4 cells). (B, D, F, and H) Graphs show means ± SEM from cells pooled from at least three experiments for each condition.

Tables

  • Table 1 Passive membrane properties of the analyzed neurons exposed to various treatments.

    All values are means ± SEM. *P < 0.05, Student’s t test. n, number of cells; Vm, resting membrane potential; Rinput, input resistance; τ, membrane time constant; Cm, membrane capacitance; ActD, actinomycin D.

    FigureTreatmentnVm (mV)Rinput (megohms)τ (ms)Cm (pF)
    1CTL16−57.6 ± 1.1570 ± 3962.7 ± 4.758.3 ± 2.6
    RG10816−62.1 ± 1.7*575 ± 5263.6 ± 5.966.7 ± 5.6
    2CTL7−60.1 ± 1.3606 ± 7563.3 ± 5.665.7 ± 4.4
    RG108 + APV5−60.4 ± 3.2478 ± 8066.4 ± 6.767.2 ± 8.3
    RG108 + NBQX + APV7−58.4 ± 2.1527 ± 5067.9 ± 7.469.2 ± 6.3
    RG108 + TTX7−58.7 ± 1.9590 ± 9677.9 ± 13.458.2 ± 5.8
    3CTL11−59.3 ± 1.2589 ± 5961.1 ± 4.760.9 ± 3.6
    RG108 + ActD4−59.3 ± 4.1579 ± 15364.1 ± 10.646.3 ± 2.0
    Scrambled CTL6−57.3 ± 1.5594 ± 3062.6 ± 4.167.0 ± 5.4
    Tet1 ASO + RG1087−61.0 ± 1.7619 ± 12160.8 ± 5.252.7 ± 7.2
    5CTL10−59.0 ± 1.3621 ± 5362.2 ± 4.755.6 ± 5.1
    RG10813−62.6 ± 1.2599 ± 5962.9 ± 6.160.7 ± 3.7
    6 (A to E)Scrambled CTL12−56.8 ± 1.1516 ± 3259.5 ± 3.955.5 ± 4.2
    Dnmt1 ASO9−58.9 ± 1.2613 ± 8361.0 ± 4.656.9 ± 7.4
    Dnmt3a ASO7−60.7 ± 2.0626 ± 6166.6 ± 7.250.4 ± 3.5
    6 (F to H)Scrambled CTL8−57.0 ± 1.0541 ± 3556.8 ± 4.160.8 ± 4.8
    Dnmt1 ASO5−58.4 ± 2.0507 ± 2255.0 ± 4.565.4 ± 11.6
    Dnmt3a ASO5−63.4 ± 2.0670 ± 7170.3 ± 9.355.2 ± 8.1
    7 (A and B, and E and F)CTL8−56.4 ± 1.0634 ± 5463.0 ± 5.850.4 ± 5.0
    CTL + apamin5−58.4 ± 3.0704 ± 4173.3 ± 4.354.9 ± 5.3
    RG10810−62.0 ± 1.4610 ± 6861.6 ± 6.556.5 ± 2.8
    RG108 + apamin4−59.8 ± 4.0683 ± 11067.8 ± 5.758.1 ± 4.0
    7 (C and D, and G and H)CTL18−58.1 ± 1.1570 ± 3862.3 ± 4.260.3 ± 2.7
    CTL + apamin5−58.4 ± 3.0704 ± 4173.3 ± 4.354.9 ± 5.3
    RG10819−62.7 ± 1.5575 ± 4863.5 ± 5.467.1 ± 5.1
    RG108 + apamin4−59.8 ± 4.0683 ± 11067.8 ± 5.758.1 ± 4.0
  • Table 2 Single AP waveform characteristics of control and RG108-treated neurons.

    These values represent the neurons used for Fig. 5. All values are means ± SEM. *P < 0.05, Student’s t test. n, number of cells; Vthr, voltage threshold.

    Treatment (n)CTL (10)RG108 (13)
    AP waveform
    Vthr (mV)−45.1 ± 0.8−48.8 ± 0.7*
    Maximal depolarization rate (mV/ms)75.4 ± 4.280.9 ± 3.7
    Amplitude (mV)75.0 ± 2.480.0 ± 1.8
    Maximal repolarization rate (mV/ms)32.5 ± 3.432.5 ± 2.7
    One-half width (ms)2.5 ± 0.22.5 ± 0.1
    fAHP (mV)−13.0 ± 1.1−12.3 ± 1.2
    mAHP (mV)−21.2 ± 1.1−17.2 ± 1.0*
    Time-to-peak AHP (ms)41.5 ± 3.038.6 ± 2.5
  • Table 3 Single AP waveform characteristics of scrambled CTL, Dnmt1 ASO–treated, and Dnmt3a ASO–treated neurons in Fig. 6.

    All values are means ± SEM. *P < 0.05, one-way ANOVA followed by Dunnett’s test. n, number of cells.

    Treatment (n)Scrambled CTL (9)Dnmt1 ASO (5)Dnmt3a ASO (5)
    AP waveform
    Vthr (mV)−45.2 ± 1.1−48.4 ± 1.6−49.6 ± 1.6
    Maximal depolarization rate (mV/ms)78.6 ± 4.781.4 ± 6.582.0 ± 2.5
    Amplitude (mV)75.8 ± 3.379.5 ± 3.182.1 ± 1.8
    Maximal repolarization rate (mV/ms)28.8 ± 7.637.8 ± 5.431.4 ± 4.5
    One-half width (ms)2.2 ± 0.12.2 ± 0.22.6 ± 1.8
    fAHP (mV)−14.9 ± 0.7−12.4 ± 1.0−12.1 ± 0.8*
    mAHP (mV)−22.8 ± 1.1−18.8 ± 1.0*−16.2 ± 1.0*
    Time-to-peak AHP (ms)37.9 ± 2.238.6 ± 3.341.8 ± 1.3
  • Table 4 Single AP waveform characteristics of neurons exposed to CTL versus CTL + apamin and RG108 versus RG108 + apamin in Fig. 7.

    All values are means ± SEM. *P < 0.05, Student’s t test. n, number of cells.

    Treatment (n)CTL (8)CTL + apamin (5)RG108 (10)RG108 + apamin (4)
    AP waveform
    Vthr (mV)−45.1 ± 1.049.0 ± 0.9−49.1 ± 0.6−47.3 ± 2.1
    Maximal depolarization rate (mV/ms)75.0 ± 4.278.2 ± 3.780.7 ± 4.573.0 ± 8.8
    Amplitude (mV)73.0 ± 2.478.3 ± 2.579.0 ± 2.072.8 ± 4.7
    Maximal repolarization rate (mV/ms)33.8 ± 3.828.4 ± 4.534.0 ± 3.428.5 ± 4.5
    One-half width (ms)2.3 ± 0.12.8 ± 0.42.4 ± 0.22.5 ± 0.2
    fAHP (mV)−13.5 ± 0.9−10.6 ± 1.2−9.4 ± 3.2−11.3 ± 2.4
    mAHP (mV)−22.7 ± 0.4−17.5 ± 1.3*17.0 ± 1.117.3 ± 2.2
    Time-to-peak (ms)40.3 ± 3.737.6 ± 3.041.1 ± 3.043.0 ± 2.8
  • Table 5

    Primers used in this study.

    GeneSense primer (5′ ≥ 3′)Antisense primer (5′ ≥ 3′)Annealing temp (⁰C)
    GapdhACCTTTGATGCTGGGGCTGGCGGGCTGAGTTGGGATGGGGACT58
    Dnmt1GTGTGCGGGAATGTGCTCGCTCAGTGGTGGTGGCACAGCGT58
    Dnmt3AAGCAAAGTGAGGACCATTACCACCATGTGTAGTGGACAGGGAAGCCA58
    Tet1GCCAACCAGGAAGAGGCGACTGGAGGAAGCCTGCAGGGGACAG58
    Kcnn1AGGTGAATGATCAGGCCAACAGCTATGAGACTTGGTAGGGCC60
    Kcnn3CACCAACTGAGGGGTGTCAAGGCTGCCAATCTGCTTTTCC60