Research ArticlePhysiology

YAP-mediated mechanotransduction determines the podocyte’s response to damage

See allHide authors and affiliations

Science Signaling  11 Apr 2017:
Vol. 10, Issue 474, eaaf8165
DOI: 10.1126/scisignal.aaf8165

A target for preventing kidney damage

In the kidney glomerulus, the elaborate foot processes of podocytes form the filtration barrier through which water, salts, and waste products pass into the urine. Proteinuria, or the appearance of protein in the urine, results when these cells or their foot processes are damaged. Using a rat model of chemically induced acute nephrosis, Rinschen et al. found that the activation of the transcriptional coactivator YAP and the expression of YAP target genes preceded proteinuria. YAP activity can be stimulated by mechanical stress, and activation of YAP in cultured podocytes depended on the stiffness of the substrate, implying that fibrosis may affect how podocytes respond to damage. Experiments in rats suggested that inhibiting YAP activity may be beneficial for patients with certain types of kidney diseases.

Abstract

Podocytes are terminally differentiated cells of the kidney filtration barrier. They are subjected to physiological filtration pressure and considerable mechanical strain, which can be further increased in various kidney diseases. When injury causes cytoskeletal reorganization and morphological alterations of these cells, the filtration barrier may become compromised and allow proteins to leak into the urine (a condition called proteinuria). Using time-resolved proteomics, we showed that podocyte injury stimulated the activity of the transcriptional coactivator YAP and the expression of YAP target genes in a rat model of glomerular disease before the development of proteinuria. Although the activities of YAP and its ortholog TAZ are activated by mechanical stress in most cell types, injury reduced YAP and TAZ activity in cultured human and mouse podocyte cell lines grown on stiff substrates. Culturing these cells on soft matrix or inhibiting stress fiber formation recapitulated the damage-induced YAP up-regulation observed in vivo, indicating a mechanotransduction-dependent mechanism of YAP activation in podocytes. YAP overexpression in cultured podocytes increased the abundance of extracellular matrix–related proteins that can contribute to fibrosis. YAP activity was increased in mouse models of diabetic nephropathy, and the YAP target CTGF was highly expressed in renal biopsies from glomerular disease patients. Although overexpression of human YAP in mice induced mild proteinuria, pharmacological inhibition of the interaction between YAP and its partner TEAD in rats ameliorated glomerular disease and reduced damage-induced mechanosignaling in the glomeruli. Thus, perturbation of YAP-dependent mechanosignaling is a potential therapeutic target for treating some glomerular diseases.

INTRODUCTION

Blood filtration in the kidney takes place in the capillary tufts of the glomeruli. Diseases of the glomerular filter are a leading cause of chronic kidney disease and end-stage renal failure. Glomerular disease is characterized by the presence of protein in the urine (proteinuria), an easily diagnosed symptom indicating defects in the renal filtration barrier (1). The renal filter comprises three layers: fenestrated glomerular endothelial cells, the glomerular basement membrane, and podocytes (2, 3). Glomerular disorders often progress to chronic kidney disease as a result of the loss of podocytes, which are the terminally differentiated kidney epithelial cells at the kidney-vasculature interface. Podocytes are postmitotic cells that cover the entire surface of the glomerular capillaries with a network of primary and smaller secondary and tertiary cellular processes (2). Terminal extensions of podocytes, called foot processes, interdigitate in a zipper-like fashion, forming very delicate and fine-tuned cell-cell contacts called slit diaphragms (2). This structure represents the outermost part of the renal filtration barrier before the urine enters Bowman’s capsule. In inherited and acquired diseases caused by podocyte damage, podocytes undergo a characteristic morphological change resulting in the simplification of podocyte structure (effacement). Because podocytes are exposed to considerable hydrostatic pressure (about 40 mmHg), these changes have partially been explained by the adaptation of damaged podocytes to imposed mechanical forces (4). Molecular and genetic studies have identified many key signaling proteins that are essential for podocyte biology and function; however, an understanding of the signaling pathways that cause effacement and loss of integrity of the kidney filtration barrier is incomplete (3).

The transcriptional coactivator Yes-associated protein (YAP), an effector of the canonical Hippo signaling pathway, has emerged as a crucial factor in renal disease. The Hippo signaling pathway controls cellular proliferation, growth, and death and has important roles in cancer, development, and regeneration (5). Activation of MST1 or MST2 (mammalian orthologs of the Drosophila melanogaster kinase Hippo) stimulates the kinases LATS1 and LATS2 to phosphorylate the transcriptional coactivators YAP and TAZ (YAP/TAZ, orthologous to Drosophila Yorkie), which sequesters YAP/TAZ in the cytoplasm (5). In the absence of MST activity, YAP/TAZ translocate into the nucleus and stimulate the expression of target genes. In addition to canonical regulation by LATS, the subcellular localization of YAP/TAZ is also strongly regulated by mechanical cues, chiefly through their interactions with various cytoplasmic proteins (69). In mice, YAP and TAZ are essential in the epithelial cells that give rise to the kidney for the proper architecture and function of this organ (1012). Both YAP and TAZ have been implicated in the pathogenesis of cystic kidney disease because their nuclear localization is increased in the epithelial cells that line cysts from patients and from a mouse model of disease (1315). In kidney fibrosis, stiffening of the extracellular matrix increases the activity of YAP in renal fibroblasts (16). Although the dynamics of YAP activity in podocytes under pathophysiological conditions that result in glomerular diseases have not been described, loss of YAP in the glomerular epithelium has been suggested to cause apoptosis of podocytes in vitro and in vivo (17).

Intraperitoneal administration of puromycin aminonucleoside (PAN) induces acute nephrosis in rats, which is used as a model for glomerular disease and podocyte injury (1820). The precise cellular mechanism of PAN action is unknown, but the nephrosis it induces results from effacement (the loss of podocyte architecture), which consists of a rarification and retraction of foot processes (2123). The response of podocyte-derived immortalized cell lines to PAN and other pharmacological stressors has been described as rearrangement and rarification of filamentous actin (F-actin) stress fibers (24), which are commonly believed to be correlated with podocyte injury (24, 25).

Here, we aimed to decipher the pathways involved in effacement and proteinuria. To delineate the cellular effects induced by PAN, we performed unbiased proteomic analyses before the induction of damage and at specific time points after induction but before the development of proteinuria. We identified YAP as a dominant and mechanosensitive effector of podocyte damage at very early stages of developing glomerular disease. Our results suggest that mechanosensation and overactivation of YAP in podocytes play key roles in the pathogenesis of glomerular disease.

RESULTS

Injury increases the abundance and activity of YAP in podocytes in vivo

Glomerular disease was induced in rats by intraperitoneal injection of a single dose of PAN, as previously described (21, 26). Treated animals exhibited proteinuria, as determined by an increase in the urinary albumin/creatinine ratio (ACR), 4 days after PAN injection, with no significant proteinuria at day 2 (Fig. 1A). We performed proteomic analyses of glomerular samples from vehicle- and PAN-injected rats at both day 2 and day 4 after treatment. We identified 2445 distinct proteins across all samples (data files S1 and S2). The transcriptional coactivator Yap1, an important effector of the Hippo signaling pathway, was among the top 10 proteins that exhibited a significant change in abundance at day 2, before proteinuria was observed (Fig. 1B). At day 4, the glomerular proteome of proteinuric rats was dominated by serum proteins (among them, albumin and complement) (Fig. 1C). Hierarchical clustering revealed that the abundance of YAP increased before the onset of proteinuria together with a cluster of 88 other proteins (Fig. 1D). Proteinuria was also associated with a strong (up to 6 log2 steps) increase of 19 proteins (among them, albumin) in the glomerular proteome at day 4. To determine whether this increased abundance of Yap1 stimulated YAP/TAZ-mediated transcription in the glomeruli, we performed quantitative analysis of mRNA expression of known YAP/TAZ target genes: Cyr61 (27), Ankrd1 (6), Ctgf (28), and Diaph3 (29) (Fig. 1E). Expression of these YAP/TAZ targets was increased at either day 2 (preceding proteinuria) or day 4 (Fig. 1E). Immunofluorescence staining of the glomeruli revealed that CTGF (connective tissue growth factor) was largely localized near the podocyte nuclear marker WT1, suggesting that the increased YAP activity in the glomerulus occurred in podocytes (Fig. 1F). In accordance, the ratio of CTGF+/WT1+ cells increased after PAN treatment (Fig. 1G). Immunoblot analyses confirmed an increased abundance of CTGF at day 2 (Fig. 1H).

Fig. 1 Proteinuria and increased YAP activity in response to glomerular injury in vivo.

(A) Urinary ACR (mg/mg) of PAN-treated rats 2 days (2d) and 4 days (4d) after treatment with PAN and in untreated controls (con). n = 3 (d4) or 4 (con, d2). Horizontal lines indicate mean. *P < 0.05, analysis of variance (ANOVA). n.s., not significant. (B and C) Volcano plot of proteins that, compared to untreated controls, exhibited a change in abundance in glomerular lysates 2 days (B) and 4 days (C) after PAN treatment. PAN-treated animals (nonproteinuric) were compared to control animals. The logarithmic P value of the difference is plotted against the log2 of the fold change. Proteins beyond the curved lines are changed with significance. YAP was one of the most increased proteins at day 2 [false discovery rate (FDR) = 0.05, s0 = 1]. Serum proteins were the most increased proteins at day 4 (FDR = 0.05, s0 = 1) but were not increased at day 2. Nasp is encoded by a YAP target gene in human cells determined in (31). LFQ, label-free quantification. (D) Hierarchical clustering of glomerular protein abundance across time. Proteins (rows) were clustered according to maximum distance. The heat map displays normalized protein LFQ intensities corresponding to protein abundance (red, high abundance; blue, low abundance). A cluster containing YAP and 88 other proteins (magenta box) was increased at day 2, before the onset of proteinuria. The graph shows time course of intensities of the defined clusters over the experiment. (E) Quantitative polymerase chain reaction (qPCR) analysis of four YAP/TAZ target genes in rat glomeruli after PAN treatment compared to untreated controls. n = 4 animals per treatment group. Error bars indicate SEM. *P < 0.05, one-way ANOVA with Tukey posttest. a.u., arbitrary units. (F) Immunofluorescence of CTGF and WT1 localization in podocytes in rat glomeruli. CTGF staining localized in podocyte cell bodies and near WT1+ nuclei. The boxed cells in the top panels are shown at higher magnification below. Scale bars, 50 μm (top) and 5 μm (bottom). (G) Quantification of CTGF+ in podocytes of PAN-treated rats. The number of CTGF+ podocytes in a single glomerulus was counted and normalized to the total number of WT1+ podocytes in the same glomerulus. n = 4 animals, 20 glomeruli per animal. *P < 0.05, one-way ANOVA with Tukey posttest. (H) Quantification of CTGF in glomeruli of PAN-treated and control rats by semiquantitative immunoblotting and densitometry. n = 4 animals per treatment group; n = 3 for day 4. Error bars represent SEM, and horizontal lines indicate mean. *P < 0.05, one-way ANOVA with Tukey posttest. Tub, β-tubulin.

We next analyzed YAP/TAZ localization within the glomeruli. YAP/TAZ was mainly cytoplasmically localized in podocytes under normal conditions, with only a few YAP/TAZ+ podocyte nuclei being observed (Fig. 2A). At day 4, the number of YAP/TAZ+ nuclei was significantly increased (Fig. 2, A and B). YAP/TAZ nuclear staining was only detected in WT1+ nuclei. Although the increase in nuclear YAP/TAZ at day 2 was not significant, Yap1 expression was increased significantly at day 2 (Fig. 2C) (17). Immunoblot analyses of glomeruli lysates revealed that YAP, but not TAZ, abundance was increased at days 2 and 4 compared to vehicle-treated controls. Quantitative proteomic profiling of the glomeruli from vehicle-treated rats revealed that TAZ was less abundant than YAP in this tissue (30) and that Taz mRNA expression actually decreased after PAN treatment (fig. S1, A and B). In contrast, the abundance of both total and phosphorylated Lats protein as well as Lats1 transcripts in the glomeruli was reduced at both time points (Fig. 2D and fig. S1C). In conclusion, PAN treatment results in increased YAP activity in rat podocytes, whereas the activity and abundance of the inhibitory upstream kinase Lats are diminished.

Fig. 2 Inhibition of Hippo signaling and activation of YAP/TAZ after injury of native renal glomeruli.

(A) Immunofluorescence showing YAP/TAZ in cryosections of renal glomeruli from PAN-treated rats. The bottom panels show a higher-magnification view of the boxed areas in the top panels. YAP/TAZ+ nuclei are marked with arrowheads. Scale bars, 50 μm (top) and 5 μm (bottom). (B) Quantification of immunofluorescence. The number of YAP/TAZ+ nuclei was blind-scored and normalized to the total number of podocytes and per animal. n = 3 animals, 150 podocytes of randomly selected glomeruli were quantified per animal. Horizontal lines indicate mean. P < 0.05, one-way ANOVA with Tukey posttest. (C) qPCR analysis of Yap1 expression in PAN-treated rats. n = 3 animals. *P < 0.05, one-way ANOVA with Tukey’s posttest. (D) Immunoblots showing YAP, TAZ, Lats1/2, and phosphorylated Lats1/2 (pLats1/2) in glomerular lysates from PAN-treated and control animals. n = 3 animals.

PAN injury reduces YAP activity in cultured podocytes

To uncover the mechanistic role of YAP in podocyte injury, we turned to an in vitro cellular model. Rearrangement of podocyte stress fibers is an indicator of the podocyte stress response in cell culture (24). We treated both nondifferentiated (proliferating) and differentiated (postmitotic) human podocytes with PAN. As expected and previously described, PAN induced a rearrangement of actin stress fibers, particularly in differentiated cells (fig. S2A). We then performed proteomics analysis on both nondifferentiated and differentiated human podocytes that had been exposed to PAN for 24 hours. In total, 3876 proteins were identified in the data set (fig. S2B and data files S3 and S4). Quantitative analysis of the nondifferentiated podocyte proteome revealed that PAN treatment caused the abundances of 14 proteins to decrease significantly. Among the decreased proteins were several classical YAP/TAZ target gene products, including Cyr61 and CTGF. We compared our data to the 273 putative human targets of YAP/TAZ transcriptional regulation previously described by Zanconato et al. (31). Of the 14 proteins that we identified as decreased, 6 were also present in that data set, and none of the proteins that increased in our data set corresponded to putative YAP/TAZ targets. When differentiated podocytes were exposed to PAN, 10 proteins encoded by annotated YAP/TAZ target genes were decreased, but none was increased (fig. S2C). In both nondifferentiated and differentiated podocytes, YAP/TAZ target genes were overrepresented in the population of proteins that decreased with PAN treatment compared to vehicle-treated controls (fig. S2D). A cumulative histogram comparing the ratios of the abundance of putative YAP target gene products with and without PAN treatment to the ratios of the abundance of all other proteins with and without PAN treatment demonstrated that PAN treatment caused the abundances of YAP/TAZ-dependent target genes to decrease upon PAN treatment (fig. S2, E and F). Thus, on a proteome-wide scale, there was a decrease in abundance of proteins encoded by YAP/TAZ target genes, suggesting that PAN-induced podocyte damage inhibits YAP/TAZ function in vitro. We also compared the proteomic changes of the PAN response after 2, 8, and 24 hours of PAN treatment (fig. S3A). Hierarchical clustering revealed no prominent changes after 2 and 8 hours but a concomitant reduction of extracellular matrix–related proteins after 24 hours (fig. S3B).

Consistent with the proteomics data, transcripts of five selected YAP/TAZ target genes (ANLN, ANKRD1, CYR61, CTGF, and DIAPH3) were also reduced by PAN treatment in nondifferentiated cultured human podocytes in a manner that depended on both the duration of PAN treatment (Fig. 3A) and the concentration of PAN (fig. S4A). Similarly, a line of undifferentiated mouse podocytes displayed a comparable decrease in expression of the three classical YAP/TAZ target genes Ankrd1, Ctgf, and Cyr61 (fig. S4B). The decrease of CTGF expression in the human podocyte cell line was further confirmed at the protein level by immunoblotting and densitometry (Fig. 3B). We also found that both total YAP/TAZ and YAP/TAZ phosphorylated at Ser127 (YAP) and Ser89 (TAZ) were decreased in the cells (Fig. 3C), whereas LATS abundance and phosphorylation did not change significantly (Fig. 3D). LATS-induced phosphorylation of YAP/TAZ at Ser127 and Ser89 should facilitate the interaction of YAP/TAZ with 14-3-3 proteins and decrease the transcriptional activity of YAP/TAZ. YAP/TAZ showed a predominant nuclear localization under control conditions, but this was not altered by PAN treatment (Fig. 3E). This implies that despite the presence of YAP/TAZ in the nucleus, the decreased abundance of YAP/TAZ was sufficient to reduce the expression of target genes. Identical experiments performed in differentiated podocytes (fig. S5) confirmed these results, including a time-dependent decrease of YAP/TAZ target gene expression (fig. S5A), a decrease in CTGF abundance (fig. S5B), a decrease in both YAP/TAZ abundance and phosphorylation (fig. S4C), and no alteration in LATS phosphorylation in response to PAN (fig. S5D). Consistent with these findings in cultured podocytes, PAN treatment reduced YAP/TAZ-TEAD transcriptional activity in reporter assays in human embryonic kidney (HEK) 293T cells (fig. S6, A and B), indicating that PAN treatment inhibits YAP/TAZ activity in culture independent of the cell type. This effect was less pronounced in the presence of overexpressed human LATS1 (fig. S6, A and B). We also observed a reduction in the abundance of transgenically expressed YAP in HEK293T cells (fig. S6C), suggesting that PAN affects YAP stability. Consistent with this observation, PAN treatment significantly induced ubiquitination of transgenically expressed mouse Yap in HEK293T cells in the presence of the proteasome inhibitor MG132 (fig. S6D), indicating that PAN could induce ubiquitin-dependent proteasomal degradation of YAP. Further mass spectrometry analysis of mouse Yap (NP_033560.1) ubiquitylated in HEK293T cells detected only one ubiquitylation site at residue K75 (fig. S6E). As determined by qPCR, expression of YAP in podocytes was not changed by PAN exposure, pointing to a posttranslational mechanism (fig. S6F). Accordingly, we found that the proteasome inhibitor MG132 (10 μM) could rescue the effect of PAN on YAP in vitro (fig. S6G).

Fig. 3 PAN-induced inhibition of YAP activity in cultured human podocytes.

(A) Analysis of gene expression of selected Hippo target genes in human podocytes treated with PAN for the indicated time points. Gene expression was measured using qPCR. n = 3. Error bars indicate SEM. *P < 0.05, two-way ANOVA with Tukey posttest. h, hours. (B) Semiquantitative analysis of CTGF by immunoblot and densitometry of lysates from PAN-treated podocytes. CTGF abundance (normalized by β-tubulin as a loading control) was measured by densitometry. n = 4 independent experiments. Error bars indicate SEM. *P < 0.05, two-way ANOVA. (C) Semiquantitative analysis of total YAP and TAZ and phosphorylated YAP (pYAP) and TAZ (pTAZ) by immunoblot and densitometry of lysates from PAN-treated podocytes. n = 5 independent experiments. Error bars indicate SEM. *P < 0.05, one-way ANOVA. (D) Semiquantitative analysis of total LATS1 and LATS1/2 phosphorylated at the activating site Ser909 (pLATS). n = 5 independent experiments. Error bars indicate SEM. (E) Immunofluorescence showing F-actin and YAP/TAZ in undifferentiated podocytes. Scale bars, 50 μm.

Substrate rigidity and mechanotransduction determine the injury-dependent YAP response

We next sought to identify the mechanism whereby PAN induced a reduction in YAP/TAZ activity in cultured cells but not in vivo. Previous studies indicated that YAP/TAZ are predominantly found in the cytoplasm of cells on a compliant matrix but are primarily localized to the nucleus and drive changes in gene expression when the cells are on a stiff substrate (7). Because standard plastic cell culture dishes are up to 106 times stiffer (based on the elastic modulus) than any basement membrane in vivo (32), we hypothesized that the differences in the elastic properties of the cellular microenvironment and the resulting differences in baseline YAP activity could dictate the YAP response upon injury (33). To test this, we seeded podocytes on soft matrices having elastic moduli within the range of those of normal tissues (1.5 and 15 kPa). Under these conditions, even nondifferentiated podocytes with large T antigen expression decelerated proliferation and adopted a ramified morphology, as compared to cells cultured in standard plastic dishes, most of which retained a rounded and more “spread-out” morphology (fig. S7). By qPCR analysis, the expression of YAP/TAZ target genes decreased significantly when podocytes were seeded on soft matrices (Fig. 4A), as compared to plastic. Strikingly, the PAN-induced decrease of YAP target genes previously observed in podocytes on plastic surface was partially reversed when cells were cultured (Fig. 4B) on soft matrix. Whereas YAP/TAZ was predominantly nuclear in cells plated on rigid plastic dishes, irrespective of PAN treatment (Fig. 3E), immunofluorescence of podocytes cultured on soft matrix (1 kPa) showed that YAP/TAZ was predominantly cytoplasmic in the absence of PAN and translocated into the nucleus upon PAN treatment (Fig. 4C).

Fig. 4 Substrate rigidity and F-actin influence the response of cultured podocytes to PAN.

(A) qPCR analysis of YAP and YAP/TAZ target gene expression in untreated, undifferentiated podocytes seeded on plastic and on soft matrices with defined elasticity coefficients of 1 and 12 kPa. n = 5 independent experiments. Error bars indicate SEM. *P < 0.05, one-way ANOVA with Dunnett’s posttest. (B) qPCR analysis of YAP and YAP/TAZ target gene expression in undifferentiated podocytes seeded on different matrices or plastic (PLAST) and treated with PAN. Changes in expression are presented as log2 fold change after PAN treatment compared to untreated controls. n = 4 (plastic) or 5 (1 and 12 kPa) independent experiments. Error bars indicate SEM. All fold changes in cells grown on 1- and 12-kPa substrates were significant as compared to cells grown on plastic. *P < 0.05, one-way ANOVA. The asterisks indicate significantly increased fold change in CTGF and ANKRD1 expression in cells grown on the 1-kPa substrate and treated with PAN as compared to untreated cells grown on the same substrate. *P < 0.05, two-tailed t test. (C) Immunofluorescence showing YAP/TAZ in podocytes seeded on matrices with a stiffness of 1 kPa and left untreated or treated with PAN. Scale bars, 50 μm. DAPI, 4′,6-diamidino-2-phenylindole. (D) qPCR analysis of YAP and YAP/TAZ target gene expression in differentiated podocytes treated with vehicle (Veh), PAN, or CytoD or pretreated with CytoD before treatment with PAN. n = 5. Error bars indicate SEM. *P < 0.05, two-tailed t test. (E) Semiquantitative immunoblot and densitometry analysis of total YAP and TAZ and phosphorylated YAP (pYAP) and TAZ (pTAZ) in differentiated podocytes treated as in (D). n = 4 independent experiments. Error bars represent SEM, and horizontal lines indicate mean. *P < 0.05 compared to vehicle, two-tailed t test; #P < 0.05 compared to treatment with CytoD alone, two-tailed t test. (F) Quantitative immunoblot and densitometry analysis of total LATS and LATS phosphorylated at Ser909 in differentiated podocytes treated as in (D). n = 4 independent experiments. Error bars represent SEM, and horizontal lines indicate mean. *P < 0.05 compared to treatment with CytoD alone, two-tailed t test.

To investigate whether the response to substrate rigidity was mediated by mechanical tension generated by the actomyosin cytoskeleton, we seeded podocytes on a normal plastic dish and depolymerized actin stress fibers (F-actin) using a low concentration of cytochalasin D (CytoD) (100 nM) (33). As expected, low-dose CytoD reduced the expression of YAP/TAZ target genes (Fig. 4D). The presence of CytoD reversed the inhibitory effect of PAN on the expression of some YAP/TAZ target genes, with some targets even exhibiting increased expression compared to untreated controls (Fig. 4D). Similarly, the presence of CytoD prevented the PAN-induced reduction in the abundance of CTGF (fig. S8A). Compared to untreated controls, CytoD treatment caused a small but significant reduction in the total abundance of YAP and TAZ but increased the abundance of phosphorylated YAP (Fig. 4E), consistent with actin-dependent regulation of YAP activity. The addition of PAN did not further reduce the total amount of YAP or TAZ but significantly reduced YAP phosphorylation compared to cells treated with CytoD alone (Fig. 4E), indicative of activation. Consistent with this, activating phosphorylation of LATS at Ser909 was further reduced in cells treated with PAN and CytoD compared to cells treated with CytoD alone (Fig. 4F). The total amount of LATS protein was reduced by PAN treatment at much later time points, independent of CytoD incubation, consistent with the observed decrease in LATS abundance in vivo (fig. S8B). In summary, our data demonstrate that PAN-induced podocyte injury stimulates YAP-mediated signaling, an effect that is masked in cultured podocytes by rigidity-dependent preactivation of YAP.

YAP/TAZ activation in podocytes induces proteins related to extracellular matrix generation

To understand how YAP signaling could affect the podocyte injury response, we studied the effects of YAP activation on the podocyte proteome. We generated stable lines of human podocytes overexpressing wild-type mouse Yap (YapWT) or an activated form of Yap with a Ser→Ala mutation at position 112 (YAPS112A), which corresponds to the inhibitory Ser127 phosphosite in human YAP, as well as the empty vector control. We chose this strategy over stimulating YAP through upstream effectors to exclude effects mediated by other targets of the upstream regulators. Through qPCR analysis, we confirmed expression of the Yap transgenes in these stably transfected lines and increased expression of YAP/TAZ target genes in these cells (fig. S9A). We performed a triplex proteomic analysis of podocytes expressing YapWT and YapS112A using dimethyl labeling (34) to perform all comparisons in a single mass spectrometry run (fig. S9B). The abundance of Yap protein was strongly increased in cells expressing either Yap protein compared to empty vector controls (fig. S9C). Both Yap-expressing cell lines also showed an overall similarity of their proteomes compared to empty vector controls (YAPWT/eV and YAPS112A/eV). The abundance of proteins encoded by YAP target genes (31) was increased as compared to proteins suggested not to be controlled by YAP. We ranked the ratios of all proteins and separated them into five quantiles. The fifth quantile that contained proteins with the strongest increase in the data set identified extracellular matrix–related proteins as the most strongly overrepresented protein group (fig. S9D). Extracellular matrix constituents, such as the collagen COL6A1, its receptor BCAM, or the fibrosis-promoting matrix metalloproteinase ADAMTS1, were among the most strongly increased proteins in both data sets. When we compared this data set to our initial study in rat glomeruli, we found that several extracellular matrix– and growth factor–related proteins (such as PLOD2, PDAP1, and PRMT5) were in the upper quantile in both the initial in vivo PAN data set (Fig. 1) and the in vitro study using cells expressing YapWT or YapS112A (fig. S9). Together, we concluded that YAP has the potential to promote the expression of extracellular matrix–related, “matrigenic” proteins in podocytes.

Activation of YAP/TAZ associates with mechanosignaling in glomerular diseases

The results of our proteomic analysis indicated that increased YAP activity could therefore potentially contribute to the thickening and subsequent stiffening of the basement membrane during podocyte injury in vivo. Cells react to increased basement membrane stiffness by increased mechanosignaling (35). We quantified this by analyzing the activation of focal adhesion kinase (FAK) and myosin light chain (MLC) (3538) in glomeruli from rats treated with PAN. Immunoblot and immunofluorescence analysis showed an increase in activated forms of FAK (phosphorylated at Tyr397) and MLC (phosphorylated at Ser18) before the development of proteinuria (fig. S10), indicative of an early increase in actomyosin-mediated mechanosignaling in the PAN injury model.

To investigate whether increased YAP-dependent mechanosignaling in podocytes could be a general principle in podocyte disease distinct from the PAN injury model, we studied diabetic nephropathy, a common complication of diabetes that is typically associated with thickening and stiffening of the glomerular basement membrane to which the podocytes adhere. Analyses of published glomerular transcriptomic data from three mouse diabetes models (39) revealed a significant increase in YAP/TAZ target gene expression. Six classical target genes (Ctgf, Cyr61, Ankrd1, Itgb2, Col8a1, and Axl), three of which we analyzed in the rat PAN model, were significantly increased after correction for multiple testing in at least two animal models (Fig. 5A). On a global level, we could map 76 bona fide target genes in human cells (31) onto the published data sets. Fifty-six of these increased in at least two of the mouse models. Strikingly, immunohistochemistry for CTGF in renal biopsies from eight patients suffering from moderate diabetic nephropathy (stages II and III) revealed a marked increase in CTGF near WT1+ podocyte nuclei (fig. 5B), as compared to healthy controls. In conclusion, we propose that hyperactivation of YAP signaling is a general hallmark of glomerular disease and that mechanosignaling may be involved in diabetic nephropathy.

Fig. 5 Overactive YAP/TAZ and repressed Hippo signaling in glomerular disease.

(A) We mined published transcriptomic data from three diabetes mouse models (39, 87) for expression of six bona fide YAP/TAZ target genes (Ankrd1, Axl, Cyr61, Ctgf, Col8a1, and Itgb2). Expression of all six genes increased significantly in at least two of the studies. P values after correction for multiple testing are shown. FC, fold change. The heat maps illustrate the z-scored expression values for each transcript (red, high expression; blue, low expression). (B) Immunofluorescence showing WT1+ podocyte nuclei and CTGF in renal biopsies from patients with moderate diabetic nephropathy (DN) (stages II and III). Exposure times for the red channel are indicated in the images. Kidney samples from tumor nephrectomy surgeries (without diabetic nephropathy) were used as a control. (C) qPCR analysis of human YAP (hYAP), endogenous Yap (mYAP), and endogenous WT1 expression in glomeruli from transgenic (tg) mice in which expression of hYAP in podocytes was induced with doxycycline compared to control mice not carrying the Pod.Cre transgene. Analysis was performed 2 days after adding doxycycline to the drinking water. Data were normalized to expression in control animals. n = 5 (tg) or 6 (con) animals. Error bars indicate SEM. ***P < 0.001, two-tailed t test. (D) qPCR analysis of YAP target gene expression in glomeruli from transgenic and control mice 2 days after inducing the hYAP transgene. n = 5 animals. *P < 0.05, two-tailed t test. (E) Urinary ACR of control and transgenic animals at 2, 7, 14, and 21 days after induction. Mixed genders were used, with equal numbers (±1) of male and female animals at each data point. n values for each time point are shown in parentheses. *P < 0.05, two-tailed Mann-Whitney test.

YAP activation is a potential druggable target in glomerular disease

From these data, it was unclear whether YAP activation was a consequence or a cause of increased basement membrane thickness or whether YAP itself acts as an upstream driver of glomerular disease. To dissect this, we used an inducible podocyte-specific transgenic (tg) mouse model (in a susceptible CD1 background) in which we placed a form of human YAP that cannot be phosphorylated by LATS (YAPS127A) with a tetracycline-responsive element under the control of a tetracycline-inducible reverse tetracycline activator (rTTA) in a glomerular disease–susceptible genetic background (fig. S11A), hereafter referred to as YAPS127A tg (40). Using littermates that did not carry the Pod.Cre transgene as controls but were fed doxycycline, we detected an increased amount of YAP mRNA in glomerular preparations from YAPS127A tg mice 2 days after induction of the transgene and no change in expression of endogenous Yap (mYap) or WT1 (Fig. 5C). Compared to rats, both YAPS127A tg and control mice showed an overall more prominent abundance of YAP in the nucleus (fig. S11B). Compared to littermates that did not carry the transgene, YAPS127A tg animals demonstrated stronger nuclear staining in some, but not all, podocytes in the presence of doxycycline induction (fig. S11B). Expression of YAP/TAZ target genes Cyr61 and Ctgf was increased at day 2, but not at later time points (Fig. 5D). After induction, YAPS127A tg mice developed mild microalbuminuria with increased ACRs, which remained significant up to day 7 (Fig. 5E). Later follow-up of transgenic and control mice demonstrated that their development was normal under continuous administration of doxycycline (follow-up time, 8 weeks) and that no overt renal phenotype was observable, suggesting the activation of an efficient compensatory mechanism (fig. S11C). In conclusion, these mice did not develop glomerular disease, although initial microalbuminuria was observable.

Last, we wondered whether the interaction between YAP and TEAD could represent a pharmacological target for treating glomerular disease or delaying its progression. We returned to the PAN rat model and injected animals with verteporfin (VP), a previously described inhibitor of YAP-TEAD interaction and activity (41). We co-injected rats with PAN + VP or with PAN + solvent [dimethyl sulfoxide (DMSO)] and assessed proteinuria by measuring the ACR in these animals. At day 4, proteinuria was significantly higher in rats treated with PAN than in animals treated with PAN + VP (Fig. 6A). This suggests that VP treatment ameliorated the development of severe proteinuria. In addition, absolute ACR values correlated significantly and strongly with Cyr61 expression (fig. S12A). There was also a significant decrease in expression of target genes Ctgf and Diaph3 in glomeruli from VP-treated rats, indicating efficiency of the YAP-TEAD inhibition (Fig. 6B). VP also inhibits the activity of STAT3 (signal transducer and activator of transcription 3) (42), but VP treatment had no effect on the expression of Stat3 targets (fig. S12B). VP also reduced mechanosignaling as indicated by phosphorylation of FAK and MLC (fig. S12, C to E). Electron microscopy analysis demonstrated that there was less effacement and a slight reduction of basement membrane thickening in the VP-treated group compared to animals injected with PAN alone (Fig. 6C).

Fig. 6 Overactive YAP/TAZ inhibition as a potential therapeutic target in glomerular disease and its hypothesized feedback mechanism.

(A) Urinary ACR of rats treated either with a single dose of PAN alone or with a single dose of PAN + VP, with VP administered daily thereafter. Urinalysis was done immediately before compounds were injected (d0, baseline) and 4 days after PAN administration (d4). n = 10 animals; P < 0.05, Kruskal-Wallis test. Error bars indicate SEM, and horizontal lines indicate mean. (B) qPCR analysis showing expression of YAP/TAZ target genes in glomeruli from rats treated with PAN or with PAN + daily VP. n = 5. Error bars represent SEM, and the dashed line indicates mRNA abundance in untreated rats. *P < 0.05, two-tailed t test. (C) Electron microscopy analysis of glomeruli from rats treated with PAN or with PAN + VP. Foot process (FP) length was reduced (indicating effacement) in the PAN + VP group as compared to the PAN-only group (884.5 ± 87.5 nm foot process width in PAN + VP versus 1232.7 ± 137 nm foot process width in PAN only; P = 0.07, n = 3 per group). BM, basement membrane. (D) Extracellular stiffness dictates the podocyte’s response to PAN, with direct implications for proteinuria. The effects of PAN are summarized as red (decrease) or green (increase) arrows. (E) Pathophysiology of glomerular diseases and the hypothesized role of YAP in response to damage stimuli. Stress first leads to an activation of YAP. Continued stress increases YAP and thereby matrix generation, basement membrane thickening, effacement, and proteinuria.

DISCUSSION

Mechanical factors such as cell geometry and substrate stiffness have been found to modulate YAP/TAZ-mediated signaling independently of the Hippo cascade through F-actin (6, 43). YAP is activated in cells cultured on a stiff substrate, and its activation positively correlates with cell spreading, whereas YAP is inactive in rounded cells grown on soft matrix (44). Podocytes are among the most extensively mechanically challenged cells in the human body (4), so it is not surprising that responding to mechanical cues is critical for the proper morphology and function of these cells (44). On stiff substrates in cell culture, nonproliferating podocytes develop artificial morphologies: They spread extensively and increase in size so much that a single cell in culture may be even larger than an entire glomerulus in vivo. Podocytes cultured on plastic dishes also have abundant stress fibers, which are not seen in vivo, and show nonphysiological activation of noncanonical (mechanical-induced) Hippo signaling (Fig. 3). Podocytes increase in size when cultured ex vivo, for instance, in glomerular outgrowth cultures or primary podocyte cultures (45, 46). Therefore, podocytes cultured on plastic might be of rather limited use for studying their response to pathophysiological stimuli.

Under normal conditions, components of the Hippo pathway are present in podocytes both in vivo and in cell culture (47), yet the role of this pathway in kidney health and disease remains unclear. On the basis of experiments using cultured cells, Wennmann et al. (47) and Campbell et al. (48) suggested a potentially antiapoptotic role of Hippo signaling in podocytes. The important role of Yap in podocytes is further supported by the fact that podocyte-specific knockout of Yap1 in mice leads to podocyte disease and the development of focal and segmental glomerulosclerosis (17). We demonstrated that PAN-induced glomerular injury in adult rats increased the abundance and activity of YAP, which may be consistent with an antiapoptotic role during podocyte stress. However, we observed that rigidity of the extracellular matrix tuned the podocyte’s response to PAN in a manner that depended on YAP/TAZ. In vivo, YAP/TAZ localize to both the nucleus and the cytoplasm under basal conditions. PAN caused an increase in YAP abundance and activity, and a marked loss of the kinase LATS, which preceded the onset of proteinuria (Fig. 6D). The strong effect on LATS suggests that the cascade of events is triggered by inhibition of canonical Hippo signaling, resulting in enhanced YAP/TAZ activity. The loss of LATS also occurred in cell culture models, but its effect was likely overridden by the rapid inhibition of YAP on a rigid plastic surface (fig. S8). Inhibition of YAP activity was observable even at the level of the proteome, suggesting that PAN may also be a potent YAP inhibitor in other in vitro systems (fig. S5). The mechanism of PAN-induced YAP inhibition involves a ubiquitylation-dependent posttranslational mechanism (Fig. 3 and fig. S5). Strikingly, when podocytes were cultured on soft matrices, the inhibitory effect of PAN on YAP/TAZ was blocked and even partially reversed, thereby resembling the in vivo situation. Moreover, inhibition of actin polymerization in differentiated, nonproliferating cells, and therefore inhibition of stress fibers, was sufficient to fully reverse the YAP inhibitory effect of PAN, possibly through inhibition of LATS phosphorylation at an activating phosphorylation site in Yap (Fig. 4) (49). Our findings are consistent with the suggestion that LATS contributes to actin-mediated control of YAP/TAZ (50) but exerts less influence on YAP/TAZ than do mechanical forces (7). However, in this specific case of podocyte disease, the reduction of LATS abundance and activity in vivo may provide a “tipping point” for increased YAP activity and thereby be a primary trigger of glomerular pathology.

It is tempting to speculate that the observed response could be part of a feedback loop contributing to glomerular disease progression. Activation of YAP/TAZ target genes in response to mechanical stress could contribute to the previously suggested antiapoptotic role of YAP/TAZ in podocytes (48, 51). However, many of the Hippo signaling targets are also involved in triggering fibrosis, most prominently CTGF (52). Such a profibrotic response would lead to a basement membrane thickening and stiffening and a further increase in YAP activation, thereby exacerbating glomerular pathology (Fig. 6E) (53, 54). Similar roles for YAP/TAZ to increase expression of matrigenic proteins have been demonstrated before in various cell types, including fibroblasts and cancer cells [reviewed in (8)]. Consistent with these observations, we observed that overexpression of YAP in podocytes induced the accumulation of several proteins known to promote fibrosis, such as COL6A1 and its receptor BCAM and ADAMTS1 (55). Several proteins were found to be increased in both the PAN model and the mouse YAP overexpression data set, including PLOD2 (procollagen-lysine,2-oxoglutarate 5-dioxygenase 2), a protein involved in inherited disorders of the extracellular matrix and connective tissue (Bruck syndrome) (56).

Our data revealed active YAP-mediated transcription in renal tissue from diabetic nephropathy patients and in mouse models of diabetes (Fig. 5). Diabetic nephropathy is one of the most important and prevalent diseases leading to dialysis and end-stage renal disease. Hallmarks of early-stage diabetic nephropathy include microalbuminuria and thickening and stiffening of the basement membrane, eventually proceeding to glomerulosclerosis associated with podocyte loss, nephrotic-range proteinuria, and end-stage renal disease (57). We noted increased expression of Hippo targets, particularly CTGF, in previously published transcriptomes of glomeruli from mouse models of diabetic nephropathy (Fig. 5) (39), consistent with previous studies (5860), and also in human biopsies from patients with moderate diabetic nephropathy (Fig. 5). Consistent with our data, the direct Hippo target gene birc5 (survivin) has been previously described to be induced in the glomeruli and podocytes of both diabetes (61) and PAN (62) injury models. From this perspective, we conclude that a balancing YAP/TAZ activity during early phases of podocyte injury could be a key to target progression of disease (Fig. 6). Pharmacological intervention with VP, a YAP inhibitor with limited specificity, simultaneously rescued mechanosignaling, podocyte effacement, and proteinuria in the rat PAN model (Fig. 6 and fig. S10). Our data are not conclusive regarding whether YAP activation is a primary cause or a consequence of glomerular pathologies. Overexpression of an activated form of YAP in podocytes caused mild and transient microalbuminuria in mice, which is consistent with a previous study reporting transient proteinuria in response to inducing Rac in podocytes with a similar expression strategy (Fig. 5 and fig. S11B) (63).

In contrast to our findings, Keyvani Chahi et al. observed a decrease in YAP abundance within hours of inducing nephrotoxic serum nephritis in mice, which is characterized by the rapid induction of nephrotic-range proteinuria (macroalbuminuria) (51). However, the pathophysiology, kinetics, and extent of proteinuria in such a rapid, immunological model of “serum sickness” are distinct from the microalbuminuria observed in our mouse experiments. We speculate that YAP/TAZ might be directly regulated by local inflammatory stimuli (Fig. 6E). It is also tempting to speculate that rapid and diffuse deposition of immunocomplexes and fibrin adjacent to the basement membrane in immunological diseases and also other glomerular diseases (6466) may abruptly and detrimentally interfere with podocyte mechanosignaling (Fig. 6E). In conclusion, reducing YAP activity to rebalance the feedback loop of YAP-mediated mechanosensation and mechanotransduction could therefore be a key concept for treating glomerular disease.

MATERIALS AND METHODS

Cell culture

Human podocytes (obtained from M. Saleem, University of Bristol) were maintained at 33°C in RPMI medium with 10% fetal bovine serum (FBS) and 1× insulin-transferrin supplement (Sigma) as previously described (67). Murine podocytes (obtained from S. Shankland, Unversity of Washington) were maintained as previously described (68, 69). Podocytes were seeded on plastic dishes coated with collagen I. Both cell lines express the SV40 large T temperature-sensitive antigen. The cell line is cultured and maintained at 33°C (termed “undifferentiated” cells). Cell cycle arrest induces the cells to differentiate. This can be achieved by shifting the cells to 37°C, which causes cell cycle arrest. Cells were differentiated for 10 days at 37°C. For isolation of RNA, cells were cultured on collagen-coated elastic matrices (1 and 12 kPa) from Matrigen. For imaging, cells were cultured on collagen-coated matrices from ibidi [elastically supported surface (ESS), 1.5 and 15 kPa]. Cell lines expressing FLAG-tagged mYAPWT and mYAPS112A were generated by lentiviral gene transfer as previously described (70). All cell lines were tested for mycoplasma contamination using a commercial kit (Venor GeM, Sigma). No cell line cross contamination was reported in the respective databases. PAN (Santa Cruz Biotechnology) was used at a concentration of 50 μg/ml unless otherwise indicated. MG132 from Calbiochem (cat. no. 474791, CAS 133407-82-6) was used at a concentration of 10 μM unless otherwise indicated. CytoD (CAS 22144-77-0) was obtained from Calbiochem and used at a concentration of 100 nM. The experiment was as follows: pretreatment of CytoD versus control for 24 hours, then addition of PAN at the indicated concentrations for another 24 hours. Chemicals were dissolved according to the manufacturer’s instructions and used at the concentrations indicated. Appropriate vehicle controls (“solvent only”) were performed for each experiment.

Constructs, transfection, and YAP/TAZ-TEAD luciferase assay

HEK293T cells were grown in Dulbecco’s modified Eagle’s medium + 10% FBS and transfected using the calcium phosphate method. The mouse YAP construct NP_033560.1 was a gift from M. Yaffe (Massachusetts Institute of Technology) and was subcloned into a pLenti6.3 and a pcDNA6 vector. pRK5-HA-ubiquitin-WT was a gift from T. Dawson (Addgene plasmid #17608) (71). For YAP/TAZ-TEAD luciferase assays, plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Thermo). YAP/TAZ-TEAD luciferase assay was performed as previously described (14).

Animals

All animal experiments were conducted according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals, as well as the German law for the welfare of animals. Rats were housed in a specific pathogen–free facility with free access to chow and water and a 12-hour day/12-hour night cycle. Animal procedures were approved by local authorities (Regierungspräsidium Freiburg G15-134) or the Landesamt für Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen. Male CD IGS rats [Crl:CD(SD)] (body weight, 101 to 125 g) were obtained from Charles River. Animals were randomly assigned to treatment groups. Animals were treated by intraperitoneal injection of either PAN (15 mg/100 g body weight) (Santa Cruz Biotechnology) dissolved in 0.9% NaCl or solvent alone (26). Kidneys were removed in deep anesthesia [ketamine (100 mg/kg) and xylazine (5 mg/kg) in 0.9% NaCl (10 μl/g)] and immediately perfused with ice-cold Hanks’ balanced salt solution (HBSS) via the renal arteries. After a renal cap was taken for immunofluorescence [frozen in optimal cutting temperature (OCT) compound], the renal cortex was removed and minced, and the glomeruli were isolated using the sieving method, which results in 95% purity of glomeruli in the preparation. The following sieve sizes were used: 180, 106, and 53 μm. The tissues were constantly rinsed with 4°C cold HBSS during glomeruli isolation. The glomeruli were collected on the lowest sieve. Purity of renal glomeruli was verified using light microscopy. The final glomerular pellet was obtained by centrifugation at 2300 rpm for 7 min and was snap-frozen in liquid nitrogen. The people harvesting and processing the glomeruli were blinded to the treatment.

The generation of YAP.127A rTTA mice was performed as previously described (40) using rTTA mice obtained from JAX (72). The YAP.127A mice were previously published and were a gift from F. Camargo. Mice were first mated to homozygosity for YAP.127A and rTTA in a 100% CD1 background. Then, these mice were mated to Pod.Cre heterozygous mice (73), resulting in mice heterozygous for YAP.127A, rTTA, and Pod.Cre (transgenic mice) and mice heterozygous for YAP.127A and rTTA but not Pod.Cre (control mice). Recombination to activate expression of the transgene was induced with doxycycline in the drinking water [5% sucrose and doxycycline (2 mg/liter)] at 3 weeks of age. Urine samples were taken after day 2, after day 7, and, subsequently, weekly. The mice were sacrificed at day 2, day 7, and week 8 after the initiation of dox treatment. Kidneys were harvested under deep anesthesia [ketamine (100 mg/kg) and xylazine (5 mg/kg) in 0.9% NaCl (10 μl/g)] and perfused with ice-cold HBSS. The glomeruli were harvested using magnetic bead perfusion as previously described (74). The glomeruli were lysed in 4% SDS buffer for protein lysates and in TRIzol for RNA preparation. Genotyping was performed on DNA extracted from tail cuts. The following genotyping primers were used: Col tetO Yap—GCACAGCATTGCGGACATGC, CCCTCCATGTGTGACCAAGG, and GCAGAAGCGCGGCCGTCTGG; rTTA—AAAGTCGCTCTGAGTTGTTAT, GCGAAGAGTTTGTCCTCAACC, and GGAGCGGGAGAAATGGATATG.

Urinary analysis

Urine was obtained by placing animals in an empty cage on a metal grid for a couple of minutes. Urinary creatinine was measured using an enzymatic colorimetric creatinine kit (Lehmann). Urinary albumin was measured using a fluorimetric albumin test kit (PR2005, Progen) with rat albumin (Sigma) or mouse albumin (Millipore) as a standard, following the manufacturer’s instructions. Evaluation of albuminuria (expressed as the ACR) was performed as previously described (75).

VP experiments

VP (BOC Sciences) was dissolved in DMSO at a concentration of 100 mg/ml and diluted with 0.9% NaCl (15 mg/100 g body weight) for intraperitoneal injection. VP was handled and injected in the dark. Treatment was initiated 12 hours before administration of PAN and was given daily up to 12 hours before sacrificing the animals. Kidneys were harvested as described above.

Immunofluorescence

For immunofluorescence of cultured cells, cells seeded on coverslips were fixed with 4% paraformaldehyde (PFA) for 20 min at room temperature, washed with phosphate-buffered saline (PBS) + 0.5 mM CaCl2 + 0.9 mM MgCl2, and blocked and permeabilized using 5% normal donkey serum (NDS) in PBS + 0.1% Triton X-100 for 20 min at room temperature. Cells were incubated in a humid chamber overnight at 4°C with the primary antibody (table S1) diluted 1:400 in PBS + 0.1% Triton X-100. Coverslips were washed with PBS and then incubated in a humid chamber for 1 hour at room temperature using the appropriate secondary antibody at the indicated dilution (table S1). Coverslips were washed in PBS and in water and mounted using ProLong DAPI mounting medium (Thermo Fisher). Cells were imaged using a Zeiss epifluorescence microscope using an apotome. Image processing was performed using the Zeiss AxioVision software or ImageJ/Fiji (76, 77). All manipulations were applied identically to all images in the data set. For all stainings, negative controls were performed (no primary antibody). For comparisons of intensity, equal exposure times were used unless otherwise indicated.

For immunofluorescence of kidney tissue, perfused rat kidneys were snap-frozen in OCT medium and sectioned onto glass slides using a cryostat (tissue section thickness, 5 μM). Sections were fixed with 4% PFA at room temperature for 2 min, washed with PBS three times, blocked and permeabilized in 5% NDS in PBS + 0.1% Triton X-100 for 1 hour, washed with PBS, and incubated with the primary antibody (table S1) diluted in PBS either overnight at 4°C or for 3 hours at room temperature. Slides were washed with PBS, and the appropriate secondary antibody was added at the indicated dilution (table S1). Slides were mounted using ProLong DAPI. Immunofluorescence for pFAK and pMLCII were performed using 7% NDS for blocking, and the primary antibodies were diluted in 130 mM NaCl, 13.3 mM Na2HPO4, 0.347 mM NaH2PO4, 0.1% NaN3, 0.2% Triton X-100, 0.041% Tween 20, and 0.02% bovine serum albumin (BSA). Sections were imaged using a Zeiss epifluorescence microscope with the apotome function enabled. For all staining, negative controls were performed (no primary antibody).

Immunofluorescence of human tissue samples

Excess formalin-fixed paraffin-embedded tissue from kidney biopsies of patients suffering from diabetic nephropathy was used. The procedure was approved by the local ethics committee (no. 09-083), and all patients gave informed consent. Experiments conformed to the principles set out in the Declaration of Helsinki. Paraffin-embedded tissue was cut into 4-μm sections, deparaffinized in xylene (VWR), and rehydrated. Samples were boiled in a pressure cooker in tris-EDTA (pH 9) for 10 min, rinsed with H2O and tris-buffered saline with Tween 20 (TBST), and blocked in 5% BSA + 5% NDS in TBST for 1 hour at room temperature. Sections were then incubated with both CTGF and WT1 primary antibodies (table S1) overnight at 4°C. Samples were washed with TBST and incubated with secondary antibodies (table S1) for 60 min at room temperature, washed with TBST three times, washed once quickly with distilled water, and finally mounted in ProLong Gold antifade containing DAPI (Invitrogen). The grade of diabetic glomerulopathy was classified according to Tervaert et al. (78).

Immunofluorescence quantification

Immunofluorescence was quantified in a blind manner. For CTGF staining, all CTGF spots in the glomerulus with a size of at least 4 μm were counted. The numbers of WT1-positive and DAPI-positive cells were also counted and used to calculate the CTGF/WT1 ratio. Parietal epithelial cells were excluded. The criterion of a YAP/TAZ-positive nucleus was YAP/TAZ staining clearly discernible from background staining in at least two-thirds of the nuclear area. The number of YAP/TAZ-positive nuclei was normalized to the number of total WT1-positive cells per animal.

Immunoblot analysis

Cells were lysed in 4% SDS buffer, and lysates were homogenized using a DNA-shredding column (Qiagen) or by heating the samples for 15 min at 95°C, followed by centrifugation for 20 min at 15°C. Protein abundance was measured using a commercial bicinchoninic acid (BCA) assay (Pierce) according to the manufacturer’s instructions. Samples were loaded on 8 or 10% SDS–polyacrylamide gels, followed by gel electrophoresis and semidry immunoblot. Membranes were blocked using 1× Roti-Block (Roth) and then decorated using the appropriate primary antibodies at the indicated dilutions (table S1) overnight at 4°C. Immunoblots were developed using the appropriate fluorescent secondary antibodies at the indicated concentration (table S1). Blots were developed using a LI-COR Odyssey system. Fluorescence of specific bands was quantified using a LI-COR Odyssey system (LI-COR Image Studio version 5.2; default settings, background = top/bottom). For all primary antibodies generated in goat, a secondary fluorescence was not available. Here, horseradish peroxidase–coupled antibodies at the indicated concentrations (table S1) were used as secondary antibodies, and signals were acquired using enhanced chemoluminescence and a FUSION developing system (Vilber). Densitometry was performed using ImageJ/Fiji (79) by measuring the area under the curve of specific band profiles. Values obtained by densitometry were normalized to loading control (for example, β-tubulin) obtained from the same blot and expressed as percentage to control for different exposure times/transfer efficiencies. Antibodies were validated using specific siRNAs (fig. S13).

Ubiquitylation assays

Ubiquitylation assays were performed as previously described (45). Briefly, cells transfected with FLAG.YAP were lysed by boiling in a buffer containing 2% SDS. Then, the sample was diluted to a final SDS concentration of less than 0.1% using a standard immunoprecipitation buffer. Then, anti-FLAG immunoprecipitation was performed. For immunoblot analysis, FLAG immunoprecipitation was performed using Sepharose beads (M2 beads), followed by elution with 2× Laemmli buffer. For nanoliquid chromatography–tandem mass spectrometry (nLC-MS/MS) analysis, FLAG immunoprecipitation was performed using 50 μl of anti-DYKDDDDK microbeads (Miltenyi Biotec), followed by washing steps on a microcolumn and in column tryptic digestion as previously described (45).

nLC-MS/MS

Cell lysates were generated by solubilizing cells in a buffer containing 8 M urea and 100 mM ammonium bicarbonate. Lysates containing solubilized proteins were vortexed and sonicated and spun down at 16,000g (4°C) in a table-top centrifuge, and the supernatant was subjected to reduction (dithiothreitol) and alkylation (iodoacetamide) as previously described (80). Urea was diluted to a concentration of 2 M using 100 mM ammonium bicarbonate, and tryptic digestion of 25 to 50 μg of protein was performed overnight (w/w ratio of 1:100). Samples were purified using StageTips (81) and subjected to nLC-MS/MS analysis. For profiling of glomerular lysates, we performed in-tip strong cation exchange fractionation of tryptic digests as previously described (69, 82). Dimethyl labeling of digested protein lysates (from empty vector, YapS112A, and YapWT podocytes) was performed as previously described with dimethyl +0 Da (light), dimethyl + 4 Da (medium), and dimethyl +8 Da (heavy) (34). The experiment was performed with three biological replicates and a label switch in the different channels in each experiment.

Peptides were separated using an nLC-MS/MS system (flow rate, 200 nl/min) as previously described (45). Briefly, peptides were separated using a 1-hour gradient (ubiquitylation site detection) or a 2.5-hour gradient (whole proteome analysis). The MS1 and MS2 spectra (top 10 method; dynamic exclusion time, 20 s) were acquired using a Q Exactive Plus mass spectrometer (Thermo Scientific) as previously described.

Bioinformatics analysis

Data generated by the mass spectrometer (.RAW file) were analyzed using MaxQuant 1.5.0.1 with default settings. The LFQ option was enabled. Match between run option was enabled. Variable modifications were methionine oxidation and the K-E-Gly-Gly residue for ubiquitylation detection (in experiments corresponding to fig. S5). FDR for peptide and protein identification was by default 0.01. Intensity-based absolute quantification values were determined within the MQ version as previously described by Schwanhäusser et al. (30). Processed data (proteingroups.txt file) were analyzed using Perseus 1.5.1.4. Two-tailed t test was performed where appropriate. To correct for multiple testing and to determine statistically significant proteins, an approach similar to significance analysis of microarrays (using s0 and FDR control) (83) was used. FDR and s0 values are indicated in the respective figure legends. For hierarchical clustering, groups were averaged and clustered using maximum distance. Gene Ontology (GO) terms and UniProt keywords were annotated using the Perseus annotation package, and enriched GO terms were determined by a Fisher’s exact test (corrected for multiple testing, FDR < 0.05).

Raw mass spectrometry data deposition

The raw data of the study have been uploaded to PRIDE/ProteomeXchange (84) with accession nos. PXD003872 (proteomic analysis of cultured podocytes), PXD003864 (proteomic analysis of glomeruli from PAN-treated rats), and PXD005182 (proteomic analysis of podocytes expressing empty vector, Yap112A, and YapWT).

Analysis of published transcriptomic data

Transcriptomic data sets from the study by Hodgin et al. (39) were initially accessed through www.nephromine.org (accessed December 2015 data now implemented in https://nephroseq.org) and searched for known YAP/TAZ target genes. For an analysis of all data, the supplementary data of the Hodgin study were accessed through Gene Expression Omnibus (GSE33744; files: GSE33744_DBA.txt, GSE33744_dbdb.txt, and GSE33744_eNOS.txt). Human gene symbols of putative YAP/TAZ target genes [obtained from the Supplementary Materials of Zanconato et al. (31)] were converted into mouse gene symbols. Genes were mapped onto the Diabetes data sets.

Quantitative polymerase chain reaction

RNA was isolated using TRIzol and the Qiagen RNEasy kit according to the manufacturer’s instructions. In-column digestion with deoxyribonuclease was performed for all samples to remove genomic DNA contamination. Quality and quantity of eluted RNA was checked using a NanoDrop spectrophotometer (Thermo). Complementary DNA (cDNA) was synthesized using the same amounts of RNA using the ABI high-capacity cDNA synthesis kit. cDNA (50 to 100 ng) was used as input for further analysis. qPCR was performed using SYBR Green assays (SYBR Green Master Mix, ABI) or probe-based qPCR assays (TaqMan Master Mix, ABI) and analyzed using a 7900HT (Applied Biosystems) or a QuantStudio 12K Flex cycler system. Primer sequences and probe-based assays are listed in tables S2 and S3. Quantification of relative expression levels was performed using the 2−ΔΔCT method as previously described (85), which involves normalization to housekeeping or reference genes. The genes Actb and Hprt were used as housekeeping genes in all three species analyzed in this study. Afterward, expression was normalized to control condition, resulting in the final “mRNA expression” parameter. Primer pairs were tested for efficiency.

Small interfering RNA transfection

Small interfering RNA (siRNA) mixes of four different siRNAs per target (Dharmacon) were transfected using Lipofectamine 2000 in HEK293T cells. The following siRNAs were used: YAP1 (L-012200-00-0005), WWTR1 (L-016083-00-0005), nontargeting (D-001810-10-05), and SMARTpool: LATS1 siRNA (L-004632-00-0005).

Electron microscopy and quantification of effacement

For electron microscopy, a small piece of rat renal cortex was immersion-fixed in 4% PFA and 1% v/v glutaraldehyde in 0.1 M phosphate buffer (PB). After postfixation (same fixative overnight at 4°C), tissue blocks were washed in 0.1 M PB, treated with OsO4 (0.5% for 60 min), and stained with uranyl acetate (1% w/v in 70% v/v ethanol). After dehydration, tissue blocks were embedded in epoxy resin (Durcupan ACM, Sigma-Aldrich), cut into 40-nm ultrathin sections on a Leica ultracut, and analyzed using an 80-kV Zeiss Leo transmission electron microscope. For quantification of foot process width in 20 randomly taken images (2100× magnification) of each animal, the width of every foot process was measured using Olympus iTEM software. Foot process effacement quantification was performed as previously described (86).

Statistics

Statistical analysis was performed using two-tailed paired or unpaired t test, one-way ANOVA, Kolmogorov-Smirnov test, Mann-Whitney test, and Kruskal-Wallis test where appropriate and as indicated in the figure legends. The analysis was performed using GraphPad Prism 5. n values represent biological replicates. Statistical analysis of proteomics data was performed using the Perseus software as indicated in the “Bioinformatics analysis” section. A P value less than 0.05 was considered significant unless otherwise indicated. Correction for multiple testing was performed as indicated in the “Bioinformatics analysis” section. We did not use means to predetermine sample size. However, the number of replicates was according to the common practice in the field. Variance was estimated to be similar between experimental groups. No quantitative data were excluded, unless the following, predefined criteria were met: immunofluorescence data, positive staining in the negative control; Western blot data, no specific staining/band; MS experiments, insufficient electrospray ionization conditions or dropping MS performance (implemented in the proteomics core routine); rat study (Fig. 1), no at least twofold increase in proteinuria after 4 days in a PAN-only–treated animal. No data were excluded in the VP treatment study.

SUPPLEMENTARY MATERIALS

www.sciencesignaling.org/cgi/content/full/10/474/eaaf8165/DC1

Fig. S1. Lack of mRNA regulation and YAP/TAZ stoichiometry determine the predominance of YAP for podocyte signaling in injury.

Fig. S2. Proteomic analysis of the PAN podocyte in vitro model demonstrates a global decrease in proteins translated from YAP/TAZ target genes.

Fig. S3. Time course analysis of PAN-induced proteomic changes in undifferentiated podocytes reveals a cluster of proteins with an extracellular matrix signature.

Fig. S4. The PAN-mediated decrease of YAP/TAZ target gene expression is concentration-dependent and can be observed in a mouse podocyte cell line.

Fig. S5. Differentiated podocytes demonstrate an inhibition of YAP signaling in response to PAN.

Fig. S6. YAP/TAZ is degraded in response to PAN in cultured cells.

Fig. S7. Growth and morphology of undifferentiated podocytes on soft and stiff matrices.

Fig. S8. Expression of the bona fide YAP target gene CTGF in cytochalasin-treated podocytes.

Fig. S9. Effect of YAP and YAPS112A overexpression on the podocyte proteome.

Fig. S10. Effect of PAN injury on mechanosignaling in vivo.

Fig. S11. Effect of podocyte-specific YAP increase in mice.

Fig. S12. Effects of VP on YAP and STAT target gene expression and on podocyte mechanosignaling.

Fig. S13. Validation of antibodies.

Table S1. List of all primary and secondary antibodies and dyes used in this study and the concentrations at which they were used.

Table S2. Primers used for qPCR.

Table S3. Primers for probe-based qPCR assays.

Data file S1. Proteomic analysis of PAN effect in rat glomeruli in Excel format.

Data file S2. Proteomic analysis of PAN effect in rat glomeruli in text format.

Data file S3. Proteomic analysis of PAN effect in human podocytes in Excel format.

Data file S4. Proteomic analysis of PAN effect in human podocytes in text format.

REFERENCES AND NOTES

Acknowledgments: We thank F. Camargo (Boston) for providing the tetracycline responsive element, YAP.127A, and rTTA mice lines. We also thank R. Herzog, M. Brütting, T. Kilic, C. Meyer, A. Wilbrand-Hennes, B. Joch, and U. Cullman for technical assistance. We acknowledge the help of the Cologne Cluster of Excellence in Cellular Stress Responses in Aging-associated Diseases (CECAD) proteomics core facility (Head: C. Frese). In addition, we express our gratitude to all members of our laboratories for helpful discussions and support. Funding: This study was supported by the German Research Foundation (Deutsche Forschungsgemeinschaft): University of Cologne Postdoctoral Grant (to M.M.R.), CRC 1140 KIDGEM (to F.G. and T.B.H.), CRC 992 (to T.B.H.), KA3217/4-1 (to M.K.), SCHE1562-2 (to B.S.), and SFB829 (to T.B.). T.B.H. was also supported by the Federal Ministry of Education and Research (BMBF) (01GM1518C), by the Else-Kröner Fresenius Stiftung (NAKSYS), by the European Research Council–ERC grant 616891, by the H2020-IMI2 consortium BEAt-DKD (Biomarker Enterprise to Attack Diabetic Kidney Disease), and by the Excellence Initiative of the German Federal and State Governments (EXC294 BIOSS II). P.K. was supported by a scholarship of the International Max Planck Research School/CECAD graduate school. M.M.R. was supported by the Fritz-Scheler-Stipendium and the Köln Fortune program (intramural grant). Author contributions: M.M.R., A.-K.H., F.G., P.K., H.H., M.P.B., R.K.G., S.B., M.H., and O.K. performed experiments. M.M.R., A.-K.H., F.G., and B.S. analyzed the data. M.M.R., M.K., H.G., and P.T.-B. provided novel tools. M.M.R, T.B.H, S.A.W., T.B., and B.S. interpreted and discussed the results. M.M.R., T.B., and B.S. conceived and designed the study. Competing interests: The authors declare that they have no competing interests. Data and materials availability: The mass spectrometry raw data are available (please see Materials and Methods for details).

Stay Connected to Science Signaling

Navigate This Article