How IGF-1R promotes cell migration
Signaling through the insulin-like growth factor 1 receptor (IGF-1R) promotes cancer progression, but therapies that limit IGF-1R signaling have performed poorly. Rieger et al. found that the residues Tyr1250 and Tyr1251, which are required for IGF-1R to support cancer cell growth (see the Focus by Crudden and Girnita), underwent autophosphorylation when cells were adherent. Experiments with IGF-1Rs containing phosphomimetic or nonphosphorylatable substitutions at these sites demonstrated that IGF-1 induced IGF-1R translocation to the Golgi, where it enhanced cell migration before being degraded or recycled to the plasma membrane. These findings show that phosphorylation-dependent trafficking of IGF-1R promotes aggressive cancer cell behaviors and may explain why targeting plasma membrane–localized IGF-1R is not effective.
Abstract
Although insulin-like growth factor 1 (IGF-1) signaling promotes tumor growth and cancer progression, therapies that target the IGF-1 receptor (IGF-1R) have shown poor clinical efficacy. To address IGF-1R activity in cancer cells and how it differs from that of the closely related insulin receptor (IR), we focused on two tyrosines in the IGF-1R C-terminal tail that are not present in the IR and are essential for IGF-1–mediated cancer cell survival, migration, and tumorigenic growth. We found that Tyr1250 and Tyr1251 (Tyr1250/1251) were autophosphorylated in a cell adhesion–dependent manner. To investigate the consequences of this phosphorylation, we generated phosphomimetic Y1250E/Y1251E (EE) and nonphosphorylatable Y1250F/Y1251F (FF) mutant forms of IGF-1R. Although fully competent in kinase activity and signaling, the EE mutant was more rapidly internalized and degraded than either the wild-type or FF receptor. IGF-1 promoted the accumulation of wild-type and EE IGF-1R within the Golgi apparatus, whereas the FF mutant remained at the plasma membrane. Golgi-associated IGF-1R signaling was a feature of migratory cancer cells, and Golgi disruption impaired IGF-1–induced signaling and cell migration. Upon the formation of new cell adhesions, IGF-1R transiently relocalized to the plasma membrane from the Golgi. Thus, phosphorylation at Tyr1250/1251 promoted IGF-1R translocation to and signaling from the Golgi to support an aggressive cancer phenotype. This process distinguishes IGF-1R from IR signaling and could contribute to the poor clinical efficacy of antibodies that target IGF-1R on the cell surface.
INTRODUCTION
The receptor tyrosine kinase (RTK) insulin-like growth factor 1 receptor (IGF-1R) and its ligands (IGF-1 and IGF-2) are widely present throughout different cell and tissue types and play essential roles in cell, organ, and organismal growth (1, 2). The IGF system is also linked to cancer risk, tumorigenesis, and tumor growth and survival and to promoting cell migration in both normal and transformed cells (3–6). Many preclinical studies have shown a clear effect of IGF-1R suppression or inhibition on limiting tumorigenesis, tumor growth, and metastatic potential (3, 4, 6). However, this has not been replicated in large-scale clinical trials, wherein IGF-1R–blocking antibodies and kinase inhibitors show an overall poor efficacy (3, 4). There are no predictive biomarkers for IGF-1R activity, and there is limited understanding of the cellular signaling events that promote resistance to or evasion of IGF-1R inhibitors.
Although IGF-1 signaling in cancer cells has been extensively studied, it is still poorly understood how IGF-1R expression, abundance, and signaling output are influenced by oncogenic and adhesion signals in different cancers. Amounts of cell surface IGF-1R may not predict responses to ligand stimulation in terms of downstream signaling output, and this is apparently influenced by the cancer cell phenotype, such as migratory versus nonmigratory (7). We and others previously demonstrated that adhesion signals enhance IGF-1R activation and signaling and that integrin-mediated signaling is essential for IGF-1 to promote cancer cell proliferation and migration [reviewed in (8)]. Moreover, the association of IGF-1R with E-cadherin and with discoidin domain receptors, which are RTKs activated by binding to collagen, can control receptor stability and signaling output (9–11).
Cooperation between integrin β1 and IGF-1R signaling involves an adhesion-dependent signaling complex composed of scaffolding proteins, focal adhesion kinase (FAK), and phosphatases that ultimately leads to activation of mitogen-activated protein kinase (MAPK) pathways (12–15). Mutation of two tyrosines (Tyr1250 and Tyr1251) in the C-terminal tail of IGF-1R is sufficient to abrogate the receptor’s function in facilitating cellular transformation, cell survival, and migration (16–18). These tyrosine residues were also found to be essential for integrating IGF-1R and adhesion signaling (14). However, these tyrosines are not present in the human insulin receptor (IR), which has an almost identical kinase domain to the IGF-1R but shares less than 50% homology with the C-terminal tail. We previously hypothesized that the function of these tyrosines may distinguish IGF-1R and IR actions in cell growth and cancer (14, 17, 19). However, despite the clear loss of IGF-1R function observed upon mutation of Tyr1250 and Tyr1251 (Tyr1250/1251) to phenylanines (Y1250F/Y1251F), and in silico predictions for phosphorylation in cells (14, 16–21), evidence for actual phosphorylation in vivo has remained elusive, as has knowledge of how this phospho-site functions. This has hindered efforts to understand how these IGF-1R tyrosines facilitate tumorigenesis or how this site may distinguish IGF-1R and IR signaling.
In this study, using mass spectroscopy and phospho-specific antibodies, we established that the IGF-1R was basally autophosphorylated on Tyr1250/1251 in cells, and this depended on IGF-1 and adhesion signaling. We determined the functions of Tyr1250/1251 phosphorylation by using a phosphomimetic mutant (Y1250E/Y1251E, referred to as the EE mutant) form of IGF-1R, which was more rapidly internalized and less stable than the wild-type (WT) IGF-1R or the Y1250F/Y1251F (FF) mutant. Upon IGF-1 stimulation, both the WT and the EE mutant IGF-1R rapidly accumulated within the Golgi apparatus, whereas the FF mutant was retained on the plasma membrane. IGF-1R localization in the Golgi apparatus was associated with migratory potential, and an intact Golgi apparatus was required for IGF-1R signaling in migrating cells. Overall, the data indicate that Tyr1250/1251 phosphorylation drives translocation of IGF-1R to the Golgi, where it contributes to a migratory phenotype. These results distinguish IGF-1R and IR function and may also explain the inefficacy of targeting cell surface IGF-1R with monoclonal antibodies in several cancers.
RESULTS
Phosphorylation of IGF-1R on Tyr1250/1251 occurs in cells
First, to address the question whether the Tyr1250/1251 site becomes phosphorylated in cells, we used mass spectroscopy and phosphopeptide analysis of IGF-1R immunoprecipitated from mouse embryonic fibroblasts derived from IGF-1R knockout (KO) mice (R- cells) transiently expressing the receptor and either serum-starved or stimulated with IGF-1. The isolation of IGF-1R phosphopeptides including Tyr1250/1251 was less efficient than isolation of other phosphopeptides from the receptor, which we attributed to the fact that these tyrosines reside within a sequence (SFYYS) that also includes phosphorylated serines (20, 22), and would thus be highly charged and difficult to capture. After peptide extraction and mass spectrometry analysis, a series of phosphopeptides was identified (ion score > 19) containing tyrosines that are known to be phosphorylated in response to IGF-1, including Tyr950 and the kinase activation site tyrosines Tyr1131, Tyr1135, and Tyr1136 (Fig. 1A). In addition, phosphopeptides were captured from both serum-starved and IGF-1–stimulated cells with phosphorylation on the Tyr1250 site, with a higher score indicating IGF-1–induced phosphorylation (Fig. 1A).
(A) Phophopeptides identified by mass spectroscopy from IGF-1R immunoprecipitated from R- cells stably expressing WT IGF-1R (R-/WT cells) after serum starvation or exposure to IGF-1. Phosphorylated (p-) IGF-1R tyrosines are indicated in red. (B) Immunoblotting for and quantification of the indicated phosphotyrosines (p-Y) in IGF-1R, the indicated phosphorylated forms of AKT and ERK, and total IGF-1R, AKT, and ERK from whole lysates of R-/WT cells. Total AKT and ERK are loading controls. Phosphotyrosine-containing proteins were quantified by densitometry, normalized to the protein loading control (total AKT, total ERK, and IGF-1R), and presented as average fold change ± SEM in the ratio of phosphorylated/total protein relative to the control condition (set to 1). (C) Immunoblotting for and quantification of the indicated phosphorylated forms of IGF-1R, total IGF-1R, ERK phosphorylated on Tyr202 and Tyr204 (p-T202/Y204), and total ERK from R-/WT cells stimulated with IGF-1 at the indicated concentrations and times after serum starvation. Quantification of phosphorylated/total IGF-1R is expressed as average fold change ± SEM relative to the control condition (set to 1). Significance was calculated using a two-sided one-sample t test. (D) Immunoblotting for and quantification of phosphorylated Tyr1250/1251 in IGF-1R (p-Y1250/1251), total IGF-1R, AKT phosphorylated at Ser473, total AKT, ERK phosphorylated at Thr202 and Tyr204, and total ERK from R-/WT cells stimulated with IGF-1, IGF-2, or insulin (INS). Densitometry quantification is presented as the average fold change ± SEM in the ratio of phosphorylated/total protein relative to the control condition. Significance was calculated using a two-sided one-sample t test. (E) Immunoblotting for IGF-1R phosphorylated on Tyr1135/1136 (p-Y1135/1136), Tyr1250/1251, and total IGF-1R from cancer cells serum-starved and stimulated with IGF-1. For all experiments, blots are representative of n ≥ 3 independent experiments, and densitometry data were derived from three or more independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001.
We next used an antibody specific for the phosphorylated Tyr1250/1251 site to further assess Tyr1250/1251 phosphorylation over time in response to either serum starvation or IGF-1. In phosphopeptide arrays, an antibody known to recognize phosphorylated Tyr1250 also detected peptides containing either the single phosphorylated site or the doubly phosphorylated site (fig. S1, A and B), and we therefore concluded that this antibody reacts with the Tyr1250/1251 phosphosite. We next compared the profile of IGF-1–stimulated phosphorylation of the Tyr1250/1251 phosphosite with the IGF-1R autophosphorylation sites Tyr950, Tyr1131, and Tyr1135/1136. This analysis demonstrated that basal amounts of Tyr950, Tyr1131, and Tyr 1135/1136 phosphorylation were low and then rapidly induced by IGF-1 at 1 to 5 min. In contrast, basal phosphorylation of Tyr1250/1251 was evident in serum-starved cells, and IGF-1–induced phosphorylation at this site accumulated more slowly than it did at the other sites (Fig. 1B). This result is consistent with the mass spectrometry analysis indicating phosphorylation in serum-starved cells (Fig. 1A).
Although IGF-1 displays greater affinity for IGF-1R than for IR, and insulin displays greater affinity for IR than for IGF-1R, each can activate the other receptor when the ligand concentration is high. Therefore, we investigated whether Tyr1250/1251 phosphorylation was influenced by ligand concentration in serum-starved R- cells expressing WT IGF-1R stimulated with IGF-1 (either 1, 10, 50, or 100 ng/ml). From this, we observed that Tyr1250/1251 phosphorylation was induced in a dose-responsive manner with the highest amounts of phosphorylation reached at 50 ng/ml (Fig. 1C). Insulin did not induce phosphorylation on Tyr1250/1251 even at 100 ng/ml, although it modestly induced phosphorylation of the kinase AKT, which is known to mediate activation of the mammalian target of rapamycin pathway, metabolism, growth, and survival, but not phosphorylation of extracellular signal–regulated kinase (ERK), known to promote mitogenic, differentiation, and migratory signals, at this concentration (Fig. 1D). IGF-2 also induced Tyr1250/1251 phosphorylation (Fig. 1D). We also observed phosphorylation on Tyr1250/1251 of endogenous IGF-1R in the cancer cell lines MDA-MB-231, Cal-51, HS-578T, and DU-145 (Fig. 1E). Again, Tyr1250/1251 phosphorylation was observed in serum-starved cells, and this increased upon IGF-1 stimulation (Fig. 1E). Together, these data demonstrate that Tyr1250/1251 phosphorylation was present in cells at low basal amounts and was induced by IGF-1 in a concentration- and time-dependent manner.
Adhesion signals and IGF-1R kinase activity are required for Tyr1250/1251 phosphorylation
Because IGF-1 enhanced phosphorylation of IGR-1R at Tyr1250/1251 and this phosphorylation event had not previously been demonstrated in cells, we next investigated whether it was a bona fide autophosphorylation site in IGF-1R. The first approach was to determine whether Tyr1250/1251 phosphorylation could be induced in the presence of an inhibitor of IGF-1R kinase activity. In serum-starved cells, Tyr1250/1251 phosphorylation was not affected by the IGF-1R kinase inhibitor BMS-754807 (Fig. 2A). However, IGF-1–mediated enhancement of Tyr1250/1251 phosphorylation was abolished by the kinase inhibitor, indicating that IGF-1–induced phosphorylation of Tyr1250/1251 was likely a result of autophosphorylation. To further test autophosphorylation, we assessed autophosphorylation of WT IGF-1R and a kinase-inactive form of IGF-1R (K1003R, an adenosine triphosphate (ATP)–binding site mutant, referred to henceforth as KR), in the absence or presence of exogenously added ATP to stimulate kinase activity. Although phosphorylation on Tyr1250/1251 was detectable on both the WT and KR receptors, this was increased by exogenous ATP on the WT but not on the KR receptor (Fig. 2B). This indicates that IGF-1R kinase activity was required for phosphorylation on Tyr1250/1251. The observation that phosphorylation was evident with the KR mutant and with WT IGF-1R in serum-starved cells also suggests that other cellular kinases may phosphorylate Tyr1250/1251.
(A) Immunoblot of the indicated phosphorylated forms of IGF-1R and total IGF-1R from whole-cell lysates of R- cells transiently expressing empty vector (EV) or WT IGF-1R (R-/WT cells) that were serum-starved followed by stimulation with IGF-1 for the indicated times. Cells were incubated with BMS-754807 for 1 hour before IGF-1 stimulation as indicated. Phosphorylated Tyr1250/1251 IGF-1R was quantified by densitometry. (B) Immunoblotting for the total IGF-1R and indicated phosphorylated forms of IGF-1R immunoprecipitated (IP) from R- cells expressing either empty vector, WT IGF-1R, or KR mutant IGF-1R that were serum-starved and stimulated with IGF-1 or FF mutant cultured in complete medium (CM). AB + B (antibody plus beads) and L + B (cell lysate plus beads) are negative controls for immunoprecipitation. Immunoprecipitates were incubated with kinase buffer containing ATP or not. IGF-1Rs phosphorylated on Tyr1250/1251 and on Tyr1135/1136 were quantified by densitometry. Protein input is shown in immunoblots for phosphorylated and total IGF-1R, AKT, and ERK. (C) Immunoblotting for and analysis of the indicated phosphorylated forms of IGF-1R and Src, total IGF-1R, and total Src from Cal-51 cells that were serum-starved, exposed to kinase inhibitors [BMS, BMS-754807 (IGF-1R inhibitor); AP-2, AP-26113 (FER inhibitor); PF, PF-573228 (FAK inhibitor); and PP2 (Src inhibitor)], and then stimulated with IGF-1. IGF-1R phosphorylated on Tyr1250/1251 IGF-1R was quantified by densitometry. (D) Immunoblotting for the indicated phosphorylated forms of IGF-1R, FAK, AKT, and ERK and total IGF-1R, FAK, AKT, and ERK from adherent (ADH) and suspension-cultured (SUS) R-/WT cells stimulated with IGF-1 for the indicated times after serum starvation. The amounts of IGF-1R phosphorylated on Tyr1250/1251 and on Tyr1135/1136, AKT phosphorylated on Ser473, and ERK phosphorylated on Thr202/Tyr204 were quantified by densitometry. (E) Immunoblotting for the indicated phosphorylated forms of IGF-1R, FAK, and ERK and total IGF-1R, FAK, and ERK in adherent and suspension-cultured Cal-51 cells serum-starved and stimulated with IGF-1. For all experiments, densitometric quantification is presented as average fold change ± SEM in the ratio of phosphorylated/total protein relative to the control condition. Significance was calculated using a two-sided one-sample or two-sample t test. n ≥ 3 independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001.
Previous studies have shown that the Tyr1250/1251 site is required for cooperative IGF-1R and adhesion signaling (14) and that IGF-1R kinase activity is influenced by adhesion signaling and adhesion-associated kinases (23, 24). Therefore, we asked whether adhesion-activated kinases [feline sarcoma-related (FER), FAK, and Src] contributed to Tyr1250/1251 phosphorylation. To test this, we used Cal-51 breast cancer cells, in which IGF-1 and adhesion signaling are active (10, 25), and measured IGF-1–induced phosphorylation at the Tyr1250/1251 site and at the Tyr1135/1136 site, which is required for full kinase activation, in the presence of either the IGF-1R kinase inhibitor BMS-754807, a FER kinase inhibitor (AP-26113), a FAK kinase inhibitor (PF-573228), or a Src kinase inhibitor (PP2) (Fig. 2C). We observed that IGF-1–induced phosphorylation on both sites was decreased by BMS, AP-26113, and PF-573228 but not by PP2 (Fig. 2C). Thus, inhibition of IGF-1R, FER, or FAK kinase activity suppressed IGF-1R autophosphorylation and full kinase activation. A requirement for adhesion signaling in full IGF-1R autophosphorylation was also observed with cells that were detached from the substratum. IGF-1–stimulated phosphorylation of the Tyr950, Tyr1131, Tyr1135/1136, and Tyr1250/1251 sites was reduced by detachment of R- cells expressing WT IGF-1R, as well as by detachment of Cal-51 and DU-145 cancer cells (Fig. 2, D and E). IGF-1–induced activation of AKT and ERK was also reduced in detached cells compared to adherent cells (Fig. 2, D and E). We conclude that both IGF-1R and adhesion signaling were essential for maximal phosphorylation of the IGF-1R on Tyr1250/1251 and that cell adhesion enhanced overall IGF-1R autophosphorylation and activation.
A Tyr1250/1251 phosphomimetic mutant IGF-1R is fully active but rapidly turned over
The next question to be addressed was how phosphorylation on the Tyr1250/1251 site contributed to IGF-1R function and signaling. To address this, we generated a phosphomimetic for this site, a mutant IGF-1R with tyrosines Tyr1250/1251 substituted by negatively charged glutamic acids, the EE mutant. When transiently transfected into either R- cells or three different cancer cell lines (MCF-7, MDA-MB-231, and DU-145) in which the IGF-1R was knocked out by CRISPR technology, the EE mutant was consistently expressed at significantly lower levels than either the WT or FF IGF-1R (Fig. 3A). A similar pattern of lower receptor protein abundance was observed in R- cells stably expressing EE IGF-1R (fig. S2A), although mRNA expression across the transfected WT, FF, and EE constructs was similar (fig. S2B). Single mutation of either Tyr1250 or Tyr1251 to glutamic acid was also sufficient to impair receptor protein abundance compared to WT IGF-1R (fig. S2C).
(A) Immunoblot of the indicated phosphorylated forms of IGF-1R and total IGF-R1 in R- cells and total IGF-1R in IGF-1R knockout (KO) MCF-7, MDA-MB-231, and DU-145 cells transiently expressing the WT, FF (Tyr1250/1251 not phosphorylatable), or EE (Tyr1250/1251 phosphomimetic) forms of IGF-1R. (B) Immunoblotting for the indicated phosphorylated forms of IGF-1R, AKT, and ERK and total IGF-1R, AKT, and ERK from R- cells transiently overexpressing the WT, FF, or EE form of IGF-1R and stimulated with IGF-1 for the indicated times after serum starvation. Significance was calculated using a two-sided two-sample t test. (C) Immunoblot of the indicated phosphorylated forms of IGF-1R and AKT and total IGF-1R and AKT in IGF-1R KO MDA-MB-231 cells transiently overexpressing IGF-1R WT, FF, or EE and stimulated with IGF-1 for the indicated times after serum starvation. For (A) to (C), densitometry quantification is presented as the average fold change ± SEM in ratio of phosphorylated/total protein relative to the control condition. n ≥ 3 independent experiments. Significance was calculated using a two-sided two-sample t test. (D) Immunoblot of total IGF-1R from R- cells transiently overexpressing IGF-1R WT, FF, or EE used to determine protein input to immunoprecipitate for in vitro kinase assays followed by immunoblotting of immunoprecipitated IGF-1R (all adjusted to EE protein amounts). Kinase assay data are presented as average fold change ± SEM in kinase activity [measured in relative luciferase units (RLU)] relative to control condition (IGF-1R WT). n = 3 independent kinase preparations. Significance was calculated using two-sided one-sample t test. *P < 0.05; ***P < 0.001.
Although present in lower amounts in cells, the EE mutant was observed to be functional and to mediate IGF-1–stimulated kinase activation and downstream signaling. Cells expressing either WT or EE IGF-1R exhibited similar IGF-1–stimulated AKT and ERK activation (Fig. 3B). The FF mutant exhibited lower IGF-1R and ERK activity than WT IGF-1R (Fig. 3B), which is consistent with previous studies (19). Transient overexpression of WT, FF, or EE IGF-1R in MDA-MB-231 IGF-1R KO cells (MDA-KO) also demonstrated that the activation of EE IGF-1R was comparable to that of WT IGF-1R, whereas it was higher than that of FF IGF-1R (Fig. 3C). In vitro kinase assays were used to compare the IGF-1R kinase activity of the EE mutant with WT IGF-1R and the FF mutant. In vitro EE IGF-1R kinase activity was similar to that of WT IGF-1R, whereas FF IGF-1R kinase activity was lower than that of WT IGF-1R (Fig. 3D), as also previously reported (17).
The lower cellular abundance of the EE mutant compared to WT IGF-1R and the FF mutant suggested that Tyr1250/1251 phosphorylation influenced the translation or stability of the IGF-1R protein. We first ruled out the possibility that low EE protein was due to impaired protein synthesis by using cycloheximide (CHX) to transiently suppress protein synthesis and then assessing the amount of newly synthesized protein over time. In these experiments, it was clear that similar amounts of WT IGF-1R and mutant IGF-1Rs were restored after CHX exposure (Fig. 4A), thereby indicating similar amounts of synthesis. We next tested whether inhibition of proteasomal or lysosomal activity could restore EE IGF-1R protein in cells. The IGF-1R protein is synthesized as a proreceptor that is processed to yield an extracellular α chain and intracellular β chain. The functional receptor is a homodimer of two α chains and two β chains that are joined by disulfide bonds. Inhibition of proteasomal activity with MG-132 for 6 hours restored the EE β chain to protein abundances that were similar to those of WT IGF-1R and FF IGF-1R in control cells, and the abundance of the pro form of the receptor was also recovered (Fig. 4B). Lysosomal inhibition with E64D and leupeptin or chloroquine (CQ) did not affect EE protein abundance (Fig. 4C), indicating that the EE mutant was not more susceptible to lysosomal degradation than WT.
(A) Immunoblot for IGF-1R from R- cells transiently expressing IGF-1R WT, FF, or EE cultured in control medium (0 hours) or medium with cycloheximide (CHX) for 24 hours followed by culture in complete medium (chase). Densitometry quantification is presented as the average fold change ± SEM in IGF-1R protein relative to the control condition. n = 3 independent experiments. Significance was calculated using one-way ANOVA. (B) Immunoblot for total IGF-1R and Snail (Zinc finger protein SNAI1) from R- cells transiently expressing IGF-1R WT, FF, or EE cultured in control medium (0 hours) or medium containing the proteasome inhibitor MG-132. (C) Immunoblots for total IGF-1R and LC3 from cells transiently expressing IGF-1R WT, FF, or EE cultured in control medium (0 hours) or medium containing the lysosome inhibitors leupeptin and E64D (Leu + E64D) or chloroquine (CQ). (D) Immunoblots for IGF-1R from R- cells transiently expressing IGF-1R WT, FF, or EE stimulated with the indicated concentrations of IGF-1 for the indicated times. For (B) to (D), densitometry quantification is presented as average fold change ± SEM in IGF-1R protein relative to control condition. n = 3 independent experiments. Significance was calculated using a two-sided one-sample or two-sample t test. *P < 0.05; **P < 0.01; ***P < 0.001.
We also investigated whether stimulation of R- cells with high or low concentrations of IGF-1 influenced the degradation of the EE and WT IGF-1R compared to the FF IGF-1R. This demonstrated that IGF-1 stimulation at either high or low IGF-1 concentrations resulted in a similar reduction in amounts of the WT and EE receptors at 6 and 12 hours, whereas the abundance of the FF receptor was not significantly reduced after 6 hours and was comparable to its abundance in unstimulated cells (Fig. 4D). Thus, the FF mutant was protected from degradation. Together, these results demonstrate that the IGF-1R EE mutant was kinase active and responsive to IGF-1 but was less stable than WT IGF-1R. The data suggest that Tyr1250/1251 phosphorylation accelerated IGF-1R protein turnover.
Tyr1250/1251 phosphorylation promotes IGF-1R translocation to the Golgi apparatus
The EE IGF-1R mutant was highly active in signaling even with low amounts of protein in the cells, so we next investigated its subcellular location and compared IGF-1–stimulated internalization and trafficking of the EE receptor with that of the WT and FF receptors. Although, as expected, the WT receptor was mainly located on the cell membrane in serum-deprived cells, we observed that a pool of IGF-1R was located at the perinuclear region in these cells (Fig. 5A). In IGF-1–stimulated cells, both WT and EE receptors were visible in large intracellular vesicles. Over time, these vesicles appeared to accumulate at the perinuclear region and were less evident at the plasma membrane (Fig. 5A). These IGF-1R–containing vesicles were overall less evident in cells expressing the FF mutant receptor, in which the receptor was predominantly located at the plasma membrane (Fig. 5A). The relative translocation patterns of WT and EE IGF-1R in cells were illustrated by showing the intensity in IGF-1R fluorescence signal along a line that was drawn diagonally from cell membrane to cell membrane through the nucleus (Fig. 5B). Without IGF-1, cells expressing the EE mutant exhibited a clear peak in IGF-1R fluorescence signal close to the nucleus. This peak was less prominent in cells expressing WT IGF-1R and was not visible in cells expressing FF IGF-1R. Over time, cells expressing either WT or EE displayed a shift in IGF-1R fluorescence signal toward the nucleus and a reduction in signal intensity near the plasma membrane.
(A) Immunofluorescence of R- cells transiently expressing the IGF-1R WT, FF, or EE mutant showing IGF-1R (green) and nuclei (blue) after serum starvation (0 min) or IGF-1 stimulation (5 and 10 min). Images are representative of n ≥ 4 experiments. (B) IGF-1R staining intensity (green) in relation to the nuclear area (blue) measured using the RGB profiler from ImageJ software along a line drawn through the cell passing through the nucleus. (C) Results of in-cell Western assay from R- cells transiently transfected with WT, FF, or EE IGF-1R probed for total (TR) and surface (SR) IGF-1R. Densitometry quantification is presented as average fold change ± SEM in IGF-1R surface protein relative to the control condition. n = 3 independent experiments. Significance was calculated using a two-sided one-sample or two-sample t test. (D) Confocal microscopy showing R- cells transiently expressing the WT, FF, or EE IGF-1R that were serum-starved for 4 hours or incubated with an antibody binding to the IGF-1R α chain (IRα). Colocalization of IGF-1R IRα antibody [detected with secondary (2°) antibody, in red] and IGF-1Rβ (green) is indicated as a yellow signal. Images are representative of n = 2 independent experiments, each with n ≥ 3 cells. *P < 0.05; **P < 0.01. Scale bars, 50 μm.
Receptor internalization was also assessed using in-cell Western assays to quantify the ratio of IGF-1R present at the plasma membrane relative to total amount of the receptor in cells that were stimulated with IGF-1. Whereas the amounts of the receptor at the cell surface declined in response to IGF-1 in cells expressing either the WT or EE receptors, the cell surface amounts of FF receptors were not altered (Fig. 5C). To test whether WT and EE IGF-1Rs were being actively internalized into vesicles, we used an antibody that recognizes the α chain of IGF-1R (IRα) and is known to induce IGF-1R internalization (3). R- cells expressing the WT, FF, or EE IGF-1R were serum-starved for 4 hours and cultured with the IRα antibody for 30 min either at 37°C (Fig. 5D) or on ice (fig. S3A) followed by staining with an antibody detecting the β chain of IGF-1R and immunofluorescence analysis for colocalization (Fig. 5D and fig. S3B). The IRα-specific antibody was internalized in vesicles after 30 min in cells expressing the WT or EE IGF-1R, whereas colocalization of IRα with the β chain was observed at the plasma membrane in cells expressing the FF mutant. We conclude that activated WT and EE IGF-1Rs were rapidly internalized into intracellular vesicles that accumulated at the perinuclear region over time. The observation that the FF mutant neither accumulated within vesicles nor underwent postendocytotic trafficking suggests that phosphorylation on Tyr1250/1251 was required for internalization and accumulation of IGF-1R at the perinuclear region.
Postendocytic trafficking of surface receptors and proteins to the Golgi apparatus has been described as retrograde trafficking and a process that may be important for cell signaling (26, 27). We therefore further investigated IGF-1R colocalization with the Golgi marker GM130 in cells expressing WT, FF, or EE IGF-1R. Over time, the WT and EE IGF-1Rs colocalized with GM130 at the cis-Golgi compartment (Fig. 6A). Colocalization of IGF-1R with a biotinylated form of the lectin Vicia villosa (VVA), which labels N-acetylgalactosamine and is a marker for both trans- and cis-Golgi, was also evident (Fig. 6B). The EE mutant was also observed at the Golgi apparatus in serum-starved cells, suggesting that phosphorylation on Tyr1250/1251 was sufficient for translocation to the Golgi. To further test whether WT and EE IGF-1Rs were present in the Golgi apparatus, we used brefeldin A (BFA) to induce cis-Golgi fragmentation (28) in R- cells expressing the WT, EE, or FF receptor. Fragmentation of the cis-Golgi resulted in lower amounts of WT and EE receptors (Fig. 6C), whereas BFA did not affect the FF mutant receptor. Together, these results indicate that IGF-1–induced internalization and accumulation of the IGF-1R in the Golgi apparatus required phosphorylation on Tyr1250/1251.
(A) Immunofluorescence of R- cells expressing WT, FF, or EE IGF-1R that were either serum-starved (0 min) or stimulated with IGF-1 (5, 10, and 30 min) showing IGF-1R (green), the cis-Golgi marker GM130 (red), and nuclei (blue). Scale bar, 50 μm. Images are representatives of n ≥ 3 independent experiments. (B) Immunofluorescence of R- cells expressing WT, FF, or EE IGF-1R after IGF-1 stimulation for the indicated times showing IGF-1R (green), the Golgi marker VVA (red or green) or GM130 (red), and nuclei (blue). Representative images of n = 2 independent experiments, with n ≥ 3 images acquired for each experiment, are shown. Scale bars, 50 μm (IGF-1R and VVA) and 20 μm (VVA/GM130). (C) Immunoblot for total IGF-1R from R- cells transiently expressing WT, FF, or EE IGF-1R cultured in control medium (0 hours) or medium containing the Golgi disruptor brefeldin A (BFA). Densitometry quantification is presented as average fold change ± SEM in IGF-1R protein relative to the control condition. n = 3 independent experiments. Significance was calculated using a two-sided one-sample or two-sample t test. *P < 0.05.
Tyr1250/1251phosphorylation and adhesion signals promote IGF-1R presence in and signaling from the Golgi
The Tyr1250/1251 site is required to support a transformed phenotype, cancer cell survival, cell migration, tumor growth, and metastasis in vivo (3, 18, 29). Because Golgi-derived signaling is implicated in cell migration (30), we hypothesized that Tyr1250/1251 phosphorylation and IGF-1R Golgi localization may be a feature of migratory cancer cells. To test this, we compared IGF-1R localization in nonmigratory MCF-7 cancer cells to that in migratory MDA-MB-231 and HS-578T cells, both of which also exhibited relatively high IGF-1R Tyr1250/1251 phosphorylation (Fig. 1E). Whereas the IGF-1R was evident at sites of focal adhesion (FA) in MCF-7 cells, it was also clearly located within the Golgi apparatus in MDA-MB-231 and HS-578T cells (Fig. 7A). IGF-1R abundance was reduced by the Golgi disruptor BFA in MDA-MB-231 and HS-578T cells, but not in MCF-7 cells (Fig. 7B). Furthermore, although disruption of the Golgi with BFA did not alter the distribution of the IGF-1R at the plasma membrane in MCF-7 cells, BFA caused dispersal of the IGF-1R from the Golgi apparatus in MDA-MB-231 and HS-578T cells (Fig. 7C). In these cells, IGF-1R staining remained visible at the leading edge within lamellipodia. IGF-1–induced phosphorylation on Tyr1250/1251 was detectable in both MCF-7 and HS-578T cells, but basal amounts of SHC [Src homology 2 (SH2) domain–containing] phosphorylation and IGF-1–induced SHC phosphorylation were impaired by BFA in HS-578T cells, but not in MCF-7 cells (Fig. 7D).
(A) Immunofluorescence of MCF-7, MDA-MB-231, and HS578T cells stained to show IGF-1R (green) and either the cis-Golgi marker GM130 or the cis/trans-Golgi marker VVA (red). Images are representative of n ≥ 3 independent experiments. (B) Immunoblot for IGF-1R from MCF-7, MDA-MB-231, and HS-578T cells cultured in control medium (0 hours) or medium containing the Golgi disruptor BFA for 4 hours. Densitometry quantification is presented as average fold change ± SEM in IGF-1R protein relative to the control condition. n ≥ 3 independent experiments. Significance was calculated using a two-sided one-sample t test. (C) Immunofluorescence of MCF-7, MDA-MB-231, and HS-578T cells cultured in control medium (0 hours) or medium containing BFA for 4 hours and stained for IGF-1R (green) and either GM130 or VVA (red). Images are representatives of n ≥ 3 independent experiments. (D) Immunoblot of the indicated phosphorylated forms of IGF-1R, SHC, and AKT and total IGR-1R, AKT, and SHC in lysates from MCF-7 and HS-578T cells stimulated with IGF-1 for the indicated time after 4-hour serum starvation in the presence or absence (Ctl) of BFA. Densitometry quantification is presented as the average fold change ± SEM in ratio of phosphorylated/total protein relative to the control condition. n ≥ 3 independent experiments. Significance was calculated using a two-sided one-sample or two-sample t test. *P < 0.05; **P < 0.01. All scale bars, 20 μm.
Because IGF-1R was observed at the lamellipodia of cells even when the Golgi was disrupted (Fig. 7C) and Tyr1250/1251 phosphorylation required adhesion signaling (Fig. 2, C to E), we next investigated whether cell adhesion controlled IGF-1R localization at the plasma membrane or Golgi in MCF-7 and HS-578T cells. IGF-1R location and phosphorylation on Tyr1250/1251 was monitored over time in response to the formation of nascent FA contacts in cells that were allowed to attach to fibronectin-coated plates and coverslips. Immunofluorescence showed that the IGF-1R was present at the plasma membrane in both cell types at 15 min after cell seeding (Fig. 8A). At this time, phosphorylation on Tyr1250/1251 was low (Fig. 8B). In MCF-7 cells, the IGF-1R was observed in FAs at 30 min after cell seeding, and it remained there for up to 60 min (Fig. 8A). In HS-578T cells, most of the IGF-1R had moved from the plasma membrane to the Golgi at 30 min and was exclusively Golgi-localized by 60 min (Fig. 8A). In MCF-7 cells, phosphorylation on Tyr1250/1251 remained low over time after cell adhesion, whereas in HS-578T cells, Tyr1250/1251 phosphorylation increased over time after adhesion (Fig. 8B). These observations indicate that the IGF-1R was rapidly recruited to nascent FAs in HS-578T cells and that IGF-1R and adhesion-dependent Tyr1250/1251 phosphorylation promoted subsequent translocation of the receptor to the Golgi.
(A) Immunofluorescence of MCF-7 and HS-578T cells stained for IGF-1R (green), the cis-Golgi marker GM130 (red), and actin (blue) at the indicated times after being cultured on fibronectin-coated coverslips. Images are representative of n ≥ 3 independent experiments. (B) Immunoblotting for the indicated phosphorylated forms of IGF-1R, FAK, AKT, and ERK and total IGF-1R, FAK, AKT, and ERK from MCF-7 and HS-578T cells cultured on fibronectin-coated plates for the indicated times. Densitometry quantification is presented as the average fold change ± SEM in ratio of phosphorylated/total IGF-1R relative to the control condition over time. n ≥ 3 independent experiments. Significance was calculated using a two-sided one-sample t test. (C) Phase-contrast images of HS-578T cells in a scratch wound assay at the indicated time points, and these cells were fixed and stained for IGF-1R (green), GM130 (red), and actin (blue). Images are representative of n = 3 independent experiments. (D) Phase-contrast images of HS-578T cells in a wounding assay in serum-free control medium (no IGF-1) or in the presence of IGF-1, with vehicle or BFA added at 0 and 6 hours after wounding. Images are representative of n = 3 independent experiments. (E) Immunofluorescence of subconfluent and confluent MCF-7 and HS-578T cells stained for IGF-1R (green) and either GM130 or actin (red). Images are representative of n = 3 independent experiments. (F) Immunoblotting for the indicated phosphorylated forms of IGF-1R, FAK, SHC, AKT, and ERK and total IGF-1R, FAK, SHC, AKT, and ERK from subconfluent (SUB) and confluent (CON) MCF-7 and HS-578T cells stimulated with IGF-1 after serum starvation. Densitometry quantification is presented as the average fold change ± SEM in ratio of phosphorylated/total protein relative to the control condition. n = 3 independent experiments. Significance was calculated using a two-sided one-sample or two sample t test. *P < 0.05; **P < 0.01; ***P < 0.001. Scale bars, 250 μm (phase) and 20 μm (fluorescence). GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Directed migration of epithelial cells requires the formation of leading edge protrusion and adhesion to the extracellular matrix (ECM), which involves the formation of new FAs (30). We therefore investigated whether the IGF-1R was recruited to FAs in migrating cells. At 6 hours after wounding a HS-578T cell monolayer, large FAs were visible at the leading edge of the migrating cells (Fig. 8C). In agreement with our earlier observations of IGF-1R at sites of adhesion in both migratory and nonmigratory cells (Fig. 7A), immunofluorescence analysis showed that the IGF-1R was clearly located within the protrusions of moving cells (Fig. 8C). In these cell cultures, it was also clear that the IGF-1R was predominantly located in the Golgi apparatus within cells that were part of the high-confluency monolayer. BFA abolished IGF-1–stimulated HS-578T cell migration (Fig. 8D), indicating that the Golgi apparatus is essential for IGF-1–promoted cell migration.
To better understand what promoted IGF-1R localization to the Golgi, we further assessed IGF-1R localization in MCF-7 and HS-578T cells that were cultured to either subconfluence, which allows for cell migration and cell-matrix contacts, or high confluence, which favors cell-cell adhesion. We observed that when cell-cell adherence was high in MCF-7 cells, the IGF-1R was located at the plasma membrane sites of cell-cell adhesion as previously described (9), whereas it was located at sites of focal cell adhesion in subconfluent cultures (Fig. 8E). In these MCF-7 cultures, basal phosphorylation on Tyr1250/1251 was present, and IGF-1–induced phosphorylation of SHC was evident (Fig. 8F). In contrast, in subconfluent HS-578T cells, the IGF-1R was located at the leading edge and in the Golgi with significant IGF-1–induced phosphorylation of Tyr1250/1251 evident, whereas in confluent cells, the IGF-1R was predominantly located in the Golgi (Fig. 8E), where constitutive Tyr1250/1251 phosphorylation was evident (Fig. 8, E and F). HS-578T cells growing under high-confluency conditions exhibited little IGF-1–stimulated SHC phosphorylation (Fig. 8F). However, induction of phosphorylation on Tyr1135/1136 and activation of AKT and ERK were present, confirming that the IGF-1R was active within the Golgi in these cells. Together, these data indicate that phosphorylation on Tyr1250/1251 promoted the accumulation of IGF-1R in the Golgi. Within the Golgi, the IGF-1R was active and induced downstream signaling. On the other hand, cell-ECM adhesion signals during cell migration enhanced IGF-1–induced phosphorylation on Tyr1250/1251, resulting in the IGF-1R being located both in the Golgi and at the leading edge of migrating cells.
DISCUSSION
Although IGF-1 signaling has a well-described function in facilitating tumorigenesis and promoting tumor growth, it is unresolved why the abundance of IGF-1R does not correlate with its activity in cancer cells and why IGF-1R–targeting drugs have been largely ineffective. Our findings here (summarized in the model in Fig. 9) explain a previously hidden activity of the IGF-1R in promoting an aggressive cancer phenotype and evading therapy. Adhesion-dependent phosphorylation of the IGF-1R on Tyr1250/1251 promoted receptor translocation from the plasma membrane to the Golgi, whence it elicited signaling and was available for transport to and from new FA sites in migrating cells. Ligand- and adhesion-stimulated Tyr1250/1251 phosphorylation and receptor internalization also accelerated the turnover of the receptor.
IGF-1 and adhesion signals promote the phosphorylation of IGF-1R at Tyr1250/1251 in both nonmigratory and migratory cells. In nonmigratory cells, the IGF-1R is predominantly located at the plasma membrane or at stable FA points. In migratory cells, the IGF-1R is predominantly located in the Golgi apparatus. Upon induction of cell migration, IGF-1R translocates from the Golgi to the leading edge of the cell, subsequently becomes phosphorylated, and returns to the Golgi, where it mediates signaling to downstream effectors, including SHC and ERK.
Previous studies have reported that IGF-1R activity and signaling can be modulated by cell adhesion signals [reviewed in (8)] and directly by adhesion-associated kinases including FAK, Src, and FER (23, 24, 31–33). The presence of Tyr1250/1251 is necessary for the integration of IGF-1R and integrin β1 signaling mediated by their corecruitment into a scaffolding complex containing receptor for activated C kinase 1(RACK-1), SHC, and other mediators that stimulate MAPK signaling (12, 14). Loss of this interaction with mutation of the tyrosines to phenylalanine results in impaired IGF-1–induced cell migration and tumor growth in vivo (14, 18). Our observations here, specifically that the phosphomimetic EE mutant (for Tyr1250/1251 phosphorylation) was more rapidly internalized and trafficked from the Golgi apparatus to the leading edge of migrating cells, indicate that phosphorylation on this site is necessary for cooperation with adhesion signaling. IGF-1 also stimulates the internalization of WT IGF-1R to the Golgi, demonstrating that this is an intrinsic component of IGF-1R signaling when it is phosphorylated on these residues. In migrating cells, the removal of IGF-1R from FA points induced by phosphorylation on Tyr1250/1251 may facilitate the disassembly of FAs to promote the migration of cells and may also explain the impaired migratory capacity of cells expressing the FF mutant, wherein the IGF-1R is retained at the plasma membrane.
It is well documented that the outcome of RTK activation and signaling can vary depending on receptor location (34–36). Compartmentalization of RTK signaling may facilitate the recruitment of different effector proteins that might be dictated by a specific cell phenotype. Emerging evidence suggests an important role for the Golgi in oncogenic RTK signaling (37–39). Overexpressed or mutated forms of the RTK MET cause ligand-independent activation and signaling from MET, including the phosphorylation of the RTK human epidermal growth factor receptor 3 (HER3; also known as ERBB3), in the Golgi (37). Similarly, mutated forms of the RTK KIT are retained in the Golgi where they are active and induce downstream signaling (38, 40–42). The RTKs vascular endothelial growth factor receptor 2, fibroblast growth factor receptor, and epidermal growth factor receptor (EGFR; also called HER1 and ERBB1) are also reported to be located at and induce signaling from the Golgi (27, 35, 43). Our findings with the IGF-1R add important knowledge to the understanding of Golgi-derived RTK signaling, because we demonstrate that trafficking of this RTK to the Golgi apparatus is promoted by a specific adhesion- and ligand-dependent phosphorylation on Tyr1250/1251. In migrating cells, the IGF-1R was located at the leading edge of nascent FAs and was subsequently rapidly trafficked back to the Golgi. This suggests that a pool of IGF-1R phosphorylated at Tyr1250/1251 is stored in the Golgi for signaling and fast trafficking back to the membrane in migrating cells. A similar trafficking route is proposed for Golgi membrane protein 1–mediated trafficking of ligand-activated EGFR in hepatocellular carcinoma (27).
We have not, however, established whether the IGF-1R is a cargo protein, whether it might participate in regulating the secretion of proteins from the Golgi, or what controls its trafficking out of the Golgi. Phosphorylation on Tyr1250/1251 was low when the IGF-1R was recruited to the membrane, which suggests that phosphatases may facilitate the dephosphorylation of Tyr1250/1251, leading to the release of IGF-1R from its Golgi location. Once located at points of nascent FAs, the IGF-1R may promote the recruitment of other interaction partners and proteins, leading to the stabilization of FAs. It is likely that the IGF-1R is subsequently removed from FAs after phosphorylation on Tyr1250/1251. An alternative possibility is that the IGF-1R traffics to the Golgi compartment as part of a multiprotein complex that is stored there for signaling.
Golgi-derived oncogenic signaling may be especially active in cell migration (30). Here, we observed that fragmentation of the Golgi impaired cell migration in the presence of IGF-1. This was associated with impaired SHC phosphorylation in migratory HS-578T cells but not in nonmigratory MCF-7 cells. This is consistent with a previously described requirement for an intact Golgi apparatus in activating the RAS pathway and ERK signaling to establish cell polarity in migrating cells (30). The observation that impaired SHC phosphorylation was not observed in nonmigratory cells suggests that different signaling outcomes can be dictated by the same receptor depending on its location and on the cell phenotype as previously suggested (7). Our data suggest that distinct cell adhesion signals have an essential function in determining IGF-1R autophosphorylation and location. Mesenchymal cancer cells exhibiting high migratory capacity and aggressiveness are often deficient in E-cadherin, which interacts with the IGF-1R and may retain it at cell-cell junctions in, for example, MCF-7 cells (9). Loss of E-cadherin would therefore be likely to alter IGF-1R localization and potentially facilitate interactions with integrins.
Activated intracellular and nuclear IGF-1R have previously been linked to an aggressive cancer phenotype. Intracellular IGF-1R is more abundant in malignant than in benign epithelium in samples from patients with prostate cancer (44), and nuclear IGF-1R has been proposed to facilitate breast and prostate cancer (45, 46). Moreover, although abundance of the IGF-1R itself is not associated with survival in patients with breast cancer, high amounts of IGF-1R phosphorylation are linked to poor outcomes (47). Our finding of Golgi-derived IGF-1R signaling offers a mechanistic explanation for these effects, because although the EE IGF-1R was present in lower amounts in cells, it retained high activity.
In summary, phosphorylation-specific trafficking of the IGF-1R to the Golgi and the association of this with aggressive cancer phenotype has important consequences for IGF-1 signaling. Phosphorylated Tyr1250/1251 could be a biomarker for identifying subsets of cancer that may not be targetable with antibodies targeting the receptor but may be amenable to other therapies that would target an IGF-1R signaling hub within the Golgi. Moreover, this phosphorylation site may distinguish IGF-1R and IR signaling in cells.
MATERIALS AND METHODS
Cell culture, ligand stimulation, and pharmacological inhibitors
R- cells, MDA-MB-231, and HS578T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM). Cal-51 were cultured in 50/50 mix of DMEM/Ham’s Nutrient F12 media. Prostate cancer DU-145 cells were cultured in RPMI 1640. Media were supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 10 mM l-glutamine, with penicillin/streptomycin (5 mg/ml) added. Cells were cultured at 37°C in a humidified atmosphere at 5% CO2. All cells were determined to be free of mycoplasma by specific DNA staining and routinely maintained in culture for up to 6 to 8 weeks for use in experiments.
For the analysis of IGF-1 stimulation in Western blotting, cells were seeded 20 hours before starvation and allowed to reach about 70% confluency. Cells were serum-starved for 4 hours followed by stimulation with the indicated concentrations of IGF-1, IGF-2, or insulin. Generally, R- cells transiently expressing the IGF-1R were stimulated with IGF-1 (10 ng/ml), and cell lines with endogenous IGF-1R were stimulated with IGF-1 (50 ng/ml).
For the analysis of detached cells (suspension), cells seeded on 10-cm plates were cultured overnight in complete medium and then starved from serum for 4 hours in total. After 3 hours, cells were enzymatically detached and left in suspension for 1 hour. Cells were then stimulated with IGF-1, centrifuged at 1000 rpm for 5 min, washed with phosphate-buffered saline (PBS), and lysed. Kinase inhibitors BMS-754807 (300 and 1000 nM; Stratech/Selleckchem, catalog no. S1124-SEL), AP-26113 (500 nM; Stratech/Selleckchem, catalog no. S7000-SEL), PF-573228 (9 μM; Tocris Bioscience, catalog no. 3239-10), and PP2 (35 μM; Sigma/Merck, catalog no. 529573-5mg) were added to cells for the last hour of 4-hour serum starvation.
The proteosomal or lysosomal inhibitors MG-132 (10 μM; Calbiochem, catalog no. 474790), leupeptin (2 μM; Sigma/Merck, catalog no. L2884-25mg), E64 (2.6 μM; Sigma/Merck, catalog no. E3132-5mg), and CQ (50 μM; Cell Signaling, catalog no. 14774) were added to cell cultures for 4 or 6 hours, and the appropriate vehicle was added to controls (0 hours). The Golgi disruptor BFA (10 μg/ml; Sigma/Merck, catalog no. B7651-5mg) was added to cells in complete medium.
Generation and transfection of IGF-1R mutants
Cells were transiently transfected with pcDNA4 plasmid encoding the WT IGF-1R or kinase-dead (K1003R) mutant and pcDNA4 plasmid encoding IGF-1R WT, FF, or EE mutants. R- cells were seeded 24 hours before transfection at a density of about 1.0 × 106 cells per 10-cm plate. Lipofectamine 2000 (Invitrogen, catalog no. 11668-019) diluted in Opti-MEM was used to transfect cells with relevant DNA plasmid (12 to 16 μg). After 24 hours, cells were reseeded for experiments at 48 hours after transfection.
MDA-MB-231, MCF-7, and DU-145 cells were seeded 24 hours before transfection to about 70% confluency in six-well or 10-cm plates for transfection with Lipofectamine 2000. All cell lines were transfected with 2 μg per six-well plate and 12 μg per 10-cm plate of pcDNA4 plasmid. Cells were reseeded in new plates at 24 hours after transfection for subsequent experiments.
IGF-1R mutants were generated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, #210518). The pcDNA4 plasmid encoding WT IGF-1R was used to generate the K1003R, Y1250/Y1251 to phenylalanine (FF) and glutamic acid (EE) mutants.
IGF-1R KO cells were generated using CRISPR technology. The IGF-1R Double Nickase Plasmid (h) (sc-400084-NIC) was obtained from Santa Cruz Biotechnology Inc., and transfection was carried out as described by the supplier protocol. Selection of transfected cells was achieved using puromycin (0.5 μg/ml for MDA-MB-231 and MCF-7 cells and 0.4 μg/ml for DU-145 cells). IGF-1R KO cell pools were selected by immunoblotting for IGF-1R and then cloned by serial dilution. IGF-1R KO clones were also subsequently pooled to ensure that they represented the original cell cultures. These pools were used for stable transfection of pcDNA4 plasmids encoding the WT, FF, or EE IGF-1R followed by selection in medium supplemented with zeocin (400 μg/ml) over 4 weeks.
SDS–polyacrylamide gel electrophoresis and Western blotting
Cells were washed with ice-cold PBS twice and lysed immediately with cold lysis buffer [20 mM tris (pH 8), 50 mM NaCl, 50 mM NaF, and 1% NP-40] containing protease and phosphatase inhibitors for 30 min on ice followed by centrifugation at 14,000 rpm for 15 min at 4°C. Samples were denatured by boiling for 5 min with 5X SDS–polyacrylamide gel electrophoresis (PAGE) loading buffer. Technical replicates of the same denatured samples (30 μg of protein) were separated on 8 to 10% gels to enable analysis of distinct IGF-1R phospho-sites. Proteins were then transferred to nitrocellulose membranes that were blocked for 1 hour at room temperature in 5% bovine serum albumin (BSA) in tris-buffered saline-T [20 mM tris, 150 mM NaCl, and 0.05% Tween 20 (pH 7.6)] (TBS-T). Primary antibodies were diluted at 1:1000 or 1:10,000 dilution for β-actin in TBS-T containing 5% milk or BSA and incubated with membranes at 4°C overnight. To detect distinct IGF-1R phospho-sites, each blot was incubated with rabbit phospho–IGF-1R or mouse/rabbit total IGF-1R antibodies and a mouse antibody detecting a protein input control (tubulin). For detection of p-Thr202/Tyr204/ERK, p-Ser473/AKT and p-Tyr239/240 blots were probed with a combination of rabbit antibody detecting the phosphorylated protein, a mouse antibody detecting the total protein, followed by mouse antibodies to detect the input control. IRDye-conjugated secondary antibodies (1:10,000) were used for detection with the Odyssey Image Scanner System (LI-COR Biosciences). Image studio quantification software was used for densitometry. Each phospho–IGF-1R protein was normalized to total IGF-1R or first to the input control and then to total IGF-1R. Other phosphoproteins were normalized to their respective total protein.
Phospho-Tyr1250/1251 antibody adsorption and IGF-1R phosphopeptide array
The phospho-Tyr1250 IGF-1R (Santa Cruz Biotechnology Inc., catalog no. SC-293102 and Biorbyt, catalog no. orb43345) was adsorbed to nitrocellulose membranes that were coated with nonphosphorylated SFYYS peptide. Membranes dotted with peptide were allowed to dry completely and blocked with PBS containing 1% BSA for 1 hour at room temperature. These membranes were then incubated with the phospho-Tyr1250 antibody for 1 hour rotating at room temperature and the antibody recovered for subsequent use in Western blotting.
Custom-made Intavis CelluSpots peptide arrays (catalog no. 32.100) containing 18–amino acid peptide sequences of the IGF-1R and the IR encompassing specific tyrosines and serines phosphorylated or nonphosphorylated immobilized on glass arrays were used to analyze the specificity of the commercial p-Tyr1250 IGF-1R antibody. The phospho-Tyr1250 antibody (1/500) was incubated with slides that were subsequently processed in the same way as Western blots.
Immunoprecipitation and in vitro kinase assays
Cells were lysed, and 0.5 to 1 mg of protein lysate was incubated with antibodies detecting IGF-IR [IGF-IRβ Antibody (C-20), catalog no. sc-713, Santa Cruz Biotechnology Inc.; IGF-1Rα Antibody (αIR3), catalog no. GR11L, Merck; IGF-IRβ Antibody, catalog no. 3027, Cell Signaling] at 1/100 dilution overnight rotating at 4°C. Immune complexes were obtained by adding 50 μl of prewashed protein G agarose beads to the antibody-lysate mix for 2 hours at 4°C. Beads were washed three times using lysis buffer, and loading dye was added to the washed beads (2×) before samples were boiled for 5 min at 95°C and centrifuged at 14,000 rpm for 2 min followed by SDS-PAGE and Western blotting. To investigate multiple IGF-1R phospho-sites, denatured samples were split for two sets of gels. The antibody detecting the phospho-site was then removed using stripping buffer (200 mM NaOH with 1% SDS) and incubated with total IGF-1R (1:1000).
The ADP-Glo Kinase Assay kit (Promega) was used for in vitro kinase assays. For kinase assay, protein inputs to immunoprecipitations of IGF-1R WT and FF were adjusted to be equivalent to EE. Beads with immunoprecipitated IGF-1R were washed twice with kinase buffer [40 mM tris (pH 7.5), 20 mM MgCl2, 2 mM MnCl2, BSA (0.1 mg/ml), 2 mM dithiothreitol, and 100 μM sodium vanadate] and then incubated with kinase buffer containing 150 μM ATP (ADP-Glo Kinase Assay) and poly(Glu, Tyr) (2 mg/ml) (4:1) (P0275, Sigma) as an exogenous substrate for 30 min, with samples mixed every 10 min. Beads were centrifuged for 30 s at 14,000 rpm, and triplicates (5 μl) of supernatant were added to a white 384-well plate for incubation with ADP-Glo (5 μl per sample) for 60 min at room temperature. The ADP-Glo Kinase detection reagent (10 μl) was added to each reaction for 30 min at room temperature, and kinase activity was measured with a luminometer (BioTek).
Mass spectrometry
Mass spectrometry for phospho-peptide mapping of the IGF-1R was carried out at the FingerPrints Proteomics Facility at the University of Dundee. IGF-1R was immunoprecipitated from R- cells transfected with pcDNA3 IGF-1R WT and that were either serum-starved or stimulated with IGF-1 were transferred as protein G agarose–bound protein precipitates to the Dundee facility, where they were subjected to trypsin/AspN digestion and enrichment of phosphor-peptides by titanium dioxide. Mass spectrometry was performed using an Orbitrap Velos system.
Quantitative polymerase chain reaction
R- cells transiently expressing WT, FF, or EE IGF-1R were prepared for RNA extraction 48 hours after transfection. RNA was extracted using the PureLink RNA Mini Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. To synthesize complementary DNA, 1 μg of RNA and the QuantiTect reverse transcription kit (Qiagen) were used. Quantitative polymerase chain reaction was performed using the Roche FastStart essential DNA Green Master Kit and the LightCycler 96 Instrument (Roche Diagnostics). Actin was used as housekeeping control. The 2 CT method was used to analyze data and to determine relative mRNA expression levels. IGF-1R mRNA expression values were normalized to actin and expressed as fold change relative to the WT IGF-1R (set to 1). The following primer set was used to detect IGF-1R: 5′ATGTCCAGGCCAAACAGGAT′3 (forward) and 5′CCTCCCACTCATCAGGAACG′3 (reverse).
Immunofluorescence
Cells were cultured on 12-mm glass coverslips, washed with PBS, fixed with 4% paraformaldehyde in PHEM (60 mM PIPES, 25 mM HEPES, 10 mM EGTA, 2 mM MgCl2; pH 6.9) buffer for 60 min at room temperature, quenched with 50 mM ammonium chloride for 20 min, and permeabilized using 0.1% Triton/PHEM for 5 min. PHEM buffer containing donkey serum (10%) was used for blocking and dilution of antibodies. Coverslips were incubated with primary antibodies at 4°C, washed with PHEM three times followed by secondary antibodies and Hoechst dye to stain nuclei. The following reagents were used: IGF-1R in mouse cells (1/200), Cell Signaling, antibody catalog no. 9750; for human cells, catalog no. 3027 (1/200 for MCF-7 cells and 1/100 for other cell lines); the cis-Golgi apparatus: GM130 (1/200; D catalog no. 610822); cis- and trans-Golgi network: biotinylated VVA (1/400; Lectin Vector Laboratories, catalog no. B-1235-2). The following fluorophore-conjugated secondary antibodies, Cy3-conjugated AffiniPure donkey anti-mouse antibody (1:1000), Alexa Fluor 488–conjucated AffiniPure donkey (1/200), Alexa Fluor 594–conjucated streptavidin (1:1000), and Alexa Fluor 488–conjucated streptavidin (1/200) were used for detection of primary antibodies. Phalloidin (tetramethyl rhodamine isothiocyanate, Sigma, catalog no. P1951 or Alexa Fluor 405, Thermo Fisher Scientific, catalog no. A30104) was used to detect actin, and Hoechst was used to stain nuclei.
To assess internalization of activated IGF-1R, cells were serum-starved for 4 hours and incubated with the IGF-1R α chain (IRα) antibody for 30 min either on ice or at 37°C. Cells were then fixed and stained with an antibody detecting the IGF-1R β chain (green). Cells were then incubated with secondary antibodies detecting either the IRα (red) or IGF-1R (green). IRα antibody bound or internalized with surface-located IGF-1R appeared yellow.
Images were acquired using a SPOT charge-coupled device camera mounted on a Nikon T600 fluorescent microscope or a Nikon DSFi1c camera attached to the Leica DM LB2 microscope. For confocal microscopy, images were acquired using an Olympus Fluoview FV1000 confocal laser scanning microscope (numerical aperture, 1.4) with a 60× immersion objective. Maximum intensity projections and z-stacks were processed in ImageJ. Brightness and contrast were adjusted in Adobe Photoshop if needed. To determine fluorescence intensity within the cells, ImageJ software was used to determine fluorescence signal intensity within the cells.
In-cell Western assays for IGF-1R
Cells were seeded at 5 × 104 cells per well in 96-well tissue culture plates in complete medium for 24 hours, washed three times with PBS, and serum-starved for 4 hours followed by stimulation with IGF-1 (10 ng/ml) for 10 min or left in serum-free medium or complete medium. Cells were immediately fixed with 100 μl of a freshly prepared fixing solution (4% formaldehyde/PHEM) and incubated at room temperature for 30 min followed by quenching with 50 mM ammonium chloride for 20 min and washing with PHEM. Cells in wells with complete medium or incubated with p-AKT/AKT and one 3X set of the secondary control antibody were permeabilized using 0.1% Triton/PHEM for 5 min and washed with PHEM. All wells were then blocked for 1 hour with 50 μl of blocking buffer (5% goat serum/PHEM). Primary antibody (IGF-1R IR3 for surface and Cell Signaling IGF-1Rβ catalog no. 3027 or p- Ser473/AKT) was added for 2 hours with gentle rocking followed by washing and incubation with secondary antibody. Goat anti-mouse IRDye 680 (1:1000) (Odyssey infrared imaging system, catalog no. 926-32220) or Goat anti-rabbit IRDye 800 (1:1000) (Odyssey infrared imaging system, catalog no. 926-32211) were used to detect primary antibodies. Syto60 (Invitrogen) was also included (1:10,000) as a cell-permeable nucleic acid stain that fluoresces at 680 nm and was detected using the Odyssey infrared scanner. Cells were washed five times with PHEM. Plates were dried, and IGF-1R (surface and total levels) intensity was quantified using the Image studio quantification software with normalization to Syto60 levels.
Cell migration assays
HS578T cells were seeded in Culture-Insert 2 Well 35-mm plates (ibidi GmbH, catalog no. 81176) (4.0 × 105 cells/ml, 70 μl per well). Cells were allowed to attach for 24 hours in serum-free medium containing either dimethyl sulfoxide (vehicle) or the Golgi disruptor BFA (10 μg/ml) for 4 hours. The wound was generated by removal of the insert, and the medium in respective dishes was then supplemented with IGF-1 (50 ng/ml). Wounds were photographed with a Nikon charge-coupled device camera connected with the Nikon Eclipse TE 300 microscope (×10 magnification) after 0 and 6 hours of migration. For immunofluorescence, HS578T cells were seeded in Culture-Insert 2 Well inserts on coverslips (ibidi GmbH, catalog no. 80209) and allowed to attach for 24 hours The wound area was photographed with a Nikon charge-coupled device camera connected with the Nikon Eclipse TE 300 microscope at 0 and 6 hours of migration. Subsequently, coverslips were recovered for immunofluorescence.
Statistical analysis
Western blot densitometry results were expressed as fold change in the ratio of phospho/total protein relative to the control condition (set to 1), which is indicated as a white bar in each graph. For calculations comparing fold change of each group to the control, one-sample t tests were used to test the null hypothesis that the expected ratio was 1. For calculations comparing fold change of groups (≠ control condition), independent two-sample t tests were used. P values were adjusted using Benjamini-Hochberg correction for multiple testing. A 3 × 3 analysis of variance (ANOVA) was conducted to examine the main effects of group and condition and the interaction between group and condition in Fig. 4A. Statistical significance was determined using a P value of <0.05, and all tests were two tailed.
SUPPLEMENTARY MATERIALS
stke.sciencemag.org/cgi/content/full/13/633/eaba3176/DC1
Fig. S1. Immunoreactivity of phosphorylated Tyr1250 IGF-1R antibody.
Fig. S2. Protein abundance and mRNA expression for WT and mutant IGF-1Rs stably expressed in R- cells.
Fig. S3. WT and EE IGF-1Rs internalize in large vesicles upon IRα antibody stimulation.
This is an article distributed under the terms of the Science Journals Default License.
