Research ArticleImmunology

STING Specifies IRF3 Phosphorylation by TBK1 in the Cytosolic DNA Signaling Pathway

See allHide authors and affiliations

Science Signaling  06 Mar 2012:
Vol. 5, Issue 214, pp. ra20
DOI: 10.1126/scisignal.2002521

Abstract

Cytosolic double-stranded DNA (dsDNA) stimulates the production of type I interferon (IFN) through the endoplasmic reticulum (ER)–resident adaptor protein STING (stimulator of IFN genes), which activates the transcription factor interferon regulatory factor 3 (IRF3); however, how STING activates IRF3 is unclear. Here, we showed that STING stimulates phosphorylation of IRF3 by the kinase TBK1 (TANK-binding kinase 1) in an in vitro reconstitution system. With this system, we identified a carboxyl-terminal region of STING that was both necessary and sufficient to activate TBK1 and stimulate the phosphorylation of IRF3. We also found that STING interacted with both TBK1 and IRF3 and that mutations in STING that selectively disrupted its binding to IRF3 abrogated phosphorylation of IRF3 without impairing the activation of TBK1. These results suggest that STING functions as a scaffold protein to specify and promote the phosphorylation of IRF3 by TBK1. This scaffolding function of STING (and possibly of other adaptor proteins) may explain why IRF3 is activated in only a subset of signaling pathways that activate TBK1.

Introduction

Innate immunity is the first line of host defense against invasion by microbial pathogens, including viruses, bacteria, and parasites. The detection of pathogens occurs through the recognition of molecular features of microorganisms known as pathogen-associated molecular patterns (PAMPs) through a set of host pattern recognition receptors (PRRs) (1). Viral RNA is recognized by membrane-bound Toll-like receptors (TLRs) in the endosome in specialized cells or by retinoic acid–inducible gene I (RIG-I)–like receptors (RLRs) in the cytosol of most, if not all, cells infected by virus (2). RLRs, including RIG-I, melanoma differentiation-associated gene 5 (MDA5), and laboratory of genetics and physiology 2 (LGP2), are essential for the recognition of cytosolic viruses. Upon viral recognition, RIG-I and MDA5 interact with and activate the adaptor protein mitochondrial antiviral signaling (MAVS, also known as IPS-1, CARDIF, and VISA) (36). Localized mainly on the outer mitochondrial membrane, MAVS triggers a cytosolic signaling cascade that leads to the activation of the transcription factors interferon (IFN) regulatory factor 3 (IRF3) and nuclear factor κB (NF-κB), which in turn induce the production of antiviral and proinflammatory cytokines, including the type I IFNs IFN-α and IFN-β (7).

Accumulation of foreign or self-DNA in the cytosol can also induce potent innate immune responses (8). Upon infection of mammalian cells with DNA viruses or bacteria, the microbial DNA is delivered into the cytosol where it is detected and triggers an immune response against the pathogen. The sensors for cytosolic DNA have been actively pursued in recent years. Whereas TLR9 detects unmethylated CpG DNA in the endolysosome, the detection of cytosolic DNA is TLR9-independent (9). Studies have shown that DNA-dependent RNA polymerase III (Pol III) converts AT-rich DNA, such as poly(dA:dT), into an RNA species that triggers the RIG-I pathway (10, 11). However, in some cell types, such as macrophages and dendritic cells, non–AT-rich DNA can induce the production of IFN-β through a Pol III–independent mechanism (12). Although DNA-dependent activator of IFN (DAI) has been suggested as a sensor of cytosolic DNA (13), DAI-deficient mice still produce IFNs in response to B-form DNA, and they have innate and adaptive immune responses that are similar to those of wild-type mice (14). Studies suggest that IFI-16, one of the PYHIN family of proteins, which are defined on the basis of containing a pyrin domain and two DNA binding HIN domains, is an intracellular DNA sensor that stimulates the production of IFN-β; however, it remains to be determined whether IFI-16 is a cytosolic DNA sensor in vivo (15). Another PYHIN protein, absent in melanoma 2 (AIM2), is a cytosolic DNA sensor that activates the inflammasome and caspase-1. Current evidence suggests that AIM2 is not involved in the induction of type I IFNs by cytosolic DNA (8). In addition, the DNA helicase DDX41 functions as a DNA sensor that stimulates type I IFN production in dendritic cells (16).

The endoplasmic reticulum (ER)–localized protein stimulator of IFN genes [STING, also known as transmembrane protein 173 (TMEM173), mediator of IRF3 activation (MITA), methionine-proline-tyrosine-serine (MPYS), and ER IFN stimulator (ERIS)] is critical for regulating the production of IFN in response to cytoplasmic DNA (1720). STING-deficient cells fail to produce type I IFN in response to transfection with double-stranded DNA (dsDNA) or infection with herpes simplex virus 1 (HSV-1) or Listeria monocytogenes (21). Furthermore, in response to stimulation with dsDNA, STING relocalizes from the ER to Golgi and assembles into punctate structures that contain the kinase TANK-binding kinase 1 (TBK1) (21, 22). It is likely that this recruitment stimulates the activation of TBK1, which results in the phosphorylation of IRF3 and the expression of genes dependent on type I IFNs. However, how STING activates TBK1 and IRF3 remains largely unknown.

To dissect the biochemical mechanisms of IRF3 activation by STING, we developed a cell-free system in which STING activates IRF3 in the cytosol. With this system, we demonstrated that a portion of the C-terminal tail of STING containing just 39 amino acid residues was necessary and sufficient to activate TBK1. Furthermore, we showed that upon stimulation of cells with DNA, STING not only activated TBK1 but also recruited IRF3 to TBK1 to activate the IRF3 pathway. Thus, a key role of STING in the DNA signaling pathway is to specify and promote the phosphorylation of IRF3 by TBK1. These results also suggest that it may be possible to develop inhibitors of IRF3 activation without affecting other targets of TBK1.

Results

STING activates IRF3 in an in vitro reconstitution system

A dsDNA containing 45 nucleotides, known as IFN stimulatory DNA (ISD), stimulates the production of IFN-β in several cell types through a mechanism that is dependent on STING, but not RIG-I, MDA5, or MAVS (15, 23). We found that transfection of the murine fibrosarcoma cell line L929 with ISD stimulated the dimerization of IRF3, which is considered a hallmark of IRF3 activation (Fig. 1A, left panel). To understand how STING, which is localized on membranes of the ER, activated IRF3 in the cytosol, we established an in vitro assay in which high-speed membrane pellets (P100) containing ER were isolated from ISD-transfected L929 cells and were incubated with cytosolic extracts (S100) from untreated L929 cells in the presence of adenosine triphosphate (ATP). The P100 fraction of cells transfected with ISD for 2 to 8 hours caused IRF3 dimerization in the presence of the S100 fraction, whereas P100 from untransfected cells had no activity (fig. S1A and Fig. 1A, right panel). This activity depended on STING because the P100 fraction from cells depleted of STING by RNA interference (RNAi) lost the ability to stimulate IRF3 dimerization (fig. S1, B and C). Consistent with other recent studies (24), we found that STING was dispensable for IRF3 activation in L929 cells infected with Sendai virus, an RNA virus (fig. S1D).

Fig. 1

STING activates IRF3 in an in vitro reconstitution system. (A) ISD activates IRF3 in L929 cells. L929 cells were transfected with ISD for the indicated times. The cytosolic supernatant (S100) was analyzed by native gel electrophoresis to observe the dimerization of endogenous IRF3 (left panel). The high-speed membrane fraction (P100) isolated from ISD-stimulated cells was incubated with cytosolic extracts (S100) from untreated L929 cells, and the dimerization of IRF3 was analyzed by native gel electrophoresis (right panel). IB, immunoblot. (B) IRF3 activation by the membrane fraction (P100) of STING-expressing cells. Cytosolic extracts (S100) from HeLa cells were incubated with the P100 fraction from HEK 293T cells transfected with plasmid expressing STING-Flag. IRF3 dimerization was analyzed by native gel electrophoresis. (C and D) IRF3 activation by STING. (C) STING-Flag and (D) His6-STING were expressed in HEK 293T and Sf9 cells, respectively, purified, and then incubated with HeLa S100 and ATP, after which they were resolved by native gel electrophoresis. Aliquots of the proteins were visualized by silver staining or Coomassie blue or by Western blotting. Data are from a single experiment representative of three independent experiments.

Overexpression of STING in cells causes IRF3 dimerization and IFN-β production (17, 19). Similarly, in our in vitro assay, incubation of the P100 fraction from human embryonic kidney (HEK) 293 cells that had been transfected to overexpress STING with cytosolic extracts from untreated HeLa cells led to IRF3 dimerization (Fig. 1B). In contrast, the P100 fraction from HEK 293 cells transfected with control vector had no activity (Fig. 1B). To determine whether STING was responsible for this activity, we purified Flag-tagged STING protein from the transfected cells with anti-Flag antibody–conjugated affinity resin and incubated the purified protein with cytosolic extracts of HeLa cells. We found that the Flag-tagged STING protein caused IRF3 dimerization in the extracts (Fig. 1C). We also expressed recombinant full-length His6-tagged STING protein in Sf9 insect cells and purified the protein with a nickel affinity resin. Although it proved difficult to purify the full-length STING protein, possibly because it contains multiple putative membrane-spanning domains, it was evident that the STING protein isolated from the Sf9 cells activated IRF3 in ATP-supplemented cytosolic extracts (Fig. 1D).

The C terminus of STING is required for IRF3 activation in vitro

To delineate the domains of STING that were required for the activation of IRF3, we first expressed His6-STING(181–379), a mutant form of STING that lacks all of the transmembrane domains, in Sf9 cells (fig. S2A). After purification, His6-STING(181–379) still contained a small amount of contaminating proteins (fig. S2B). Nevertheless, it was evident that His6-STING(181–379) activated IRF3 in cytosolic extracts (fig. S2C), suggesting that the transmembrane domains of STING were dispensable for IRF3 activation in this in vitro assay. Because deletion of the transmembrane domains of STING prevents the activation of IRF3 in cells (17), a fraction of the recombinant STING fragment may be ectopically activated by overexpression, bypassing the requirement for the TM domains.

We constructed a series of deletion mutants of STING and expressed them in Escherichia coli (Fig. 2A). After purification, the protein fragments were incubated with ATP-supplemented cytosolic extracts from HeLa cells (Fig. 2, B and C). Western blotting analysis of IRF3 showed that the STING fragment spanning amino acid residues 281 to 379 caused IRF3 dimerization (Fig. 2B). We confirmed the dimerization of IRF3 in experiments with in vitro–translated [35S]-IRF3 as a substrate (fig. S2D) and by detecting phosphorylated IRF3 (pIRF3) with an antibody specific for phosphorylated Ser396 (fig. S2E), which is important for IRF3 activation (25). Furthermore, mutation of two other serines to alanines at the C terminus of IRF3, Ser385 and Ser386, which are phosphorylated in response to stimulation and are important for IRF3 activation (26), abolished the dimerization of IRF3 in vitro (fig. S2F). Together, these results show that recombinant STING(281–379) purified from E. coli stimulated the phosphorylation and subsequent dimerization of IRF3.

Fig. 2

The C terminus of STING is important for IRF3 activation in vitro. (A) Diagrams of full-length and truncated STING proteins. TM, transmembrane domain. His6-tagged proteins expressed in and purified from E. coli were analyzed by Coomassie blue staining (lower panel). (B and C) His6-STING deletion mutants were incubated with ATP-supplemented HeLa S100, and then IRF3 dimerization was analyzed by native gel electrophoresis. (D) His6-STING(341–379) was fractionated by gel filtration on Superdex 200. Each fraction was analyzed by IRF3 dimerization assay (upper panel) and Western blotting (lower panel). SM, starting material. Data are representative of at least three independent experiments. (E) L929 cells stably expressing shRNA specific for mouse STING with or without the simultaneous expression of WT human STING-Flag were transfected with ISD for the indicated times, and then membrane fractions (P100) were resolved by native-PAGE or SDS-PAGE followed by Western blotting with an antibody against STING. Cytosolic extracts (S100) were also analyzed by Western blotting with an antibody against IRF3 after native PAGE. (F) Similar to (E), except that mouse macrophage RAW 264.7 cells were transfected with ISD to detect the aggregation of endogenous STING. Data are from a single experiment representative of three independent experiments.

We found that a STING fragment containing only 39 amino acid residues (341 to 379) was sufficient to activate IRF3 in the cytosolic extracts (Fig. 2B). Further deletion of just three amino acid residues from the C terminus abrogated this activity (Fig. 2C). When His6-STING(341–379) was fractionated by gel filtration, a small amount of the protein eluted in the high–molecular mass fractions (Fig. 2D). Only the high–molecular mass fractions activated IRF3 when incubated with cytosolic extracts. Furthermore, native gel electrophoresis revealed a smear of STING aggregates of high molecular mass that appeared after 2 hours of ISD stimulation of L929 cells in which endogenous STING was knocked down and replaced with Flag-tagged STING; this smear disappeared in cells depleted of STING by RNAi (Fig. 2E). We also observed aggregates of endogenous STING in RAW 264.7 cells, a mouse macrophage cell line, in response to stimulation with ISD (Fig. 2F). These results suggest that STING may form aggregates to activate IRF3.

STING directly activates TBK1 in vitro

We next attempted to isolate the components of the cytosolic extract (S100) that were involved in the STING-dependent activation of IRF3. Studies have shown that cells deficient in the NF-κB essential modulator (NEMO, also known as IKK-γ) fail to activate IRF3 in response to infection by certain RNA viruses (27, 28), suggesting that NEMO, which forms a complex with TANK and TBK1, is important for IRF3 activation in the RIG-I pathway. Because most endogenous NEMO is incorporated into the IKK complex, which also contains the catalytic subunits IKKα and IKKβ, we reconstituted NEMO-deficient mouse embryo fibroblasts (MEFs) with Flag-tagged NEMO that lacks the N-terminal 85 residues (Flag-NEMO-ΔN) (28). Flag-NEMO-ΔN cannot form a complex with IKKα or IKKβ but it can still interact with TBK1 and TANK, which enabled us to pull down the NEMO-TANK-TBK1 complex (Fig. 3A). This complex, herein referred to as Flag-NEMO pull-down (PD), supported IRF3 dimerization in the presence of His6-STING(341–379) and ATP (Fig. 3B).

Fig. 3

STING directly activates TBK1 in vitro. (A) MEFs stably expressing Flag-NEMO-ΔN were used to isolate endogenous TBK1 by virtue of its association with Flag-NEMO-ΔN. The composition of this complex, denoted as Flag-NEMO PD, was analyzed by Western blotting with the indicated antibodies. HEK 293T cells stably overexpressing Flag-TBK1 were used to isolate recombinant TBK1 protein, denoted as Flag-TBK1 PD. (B) Flag-NEMO PD, which contained endogenous TBK1 as shown in (A), was incubated with His6-STING(341–379) (~2 μM) and His6-IRF3 (~40 nM) in the presence of ATP. IRF3 dimerization was analyzed by native gel electrophoresis. (C) S20 from WT or NEMO-deficient MEFs was incubated with varying concentrations of His6-STING(341–379) (0.375, 0.75, and 1.5 μM) together with [35S]-IRF3. IRF3 dimerization was analyzed by native gel electrophoresis followed by autoradiography. (D) Similar to (B), except that the Flag-TBK1 PD complex was used. (E) GST-TBK1 was purified from Sf9 cells and analyzed by Coomassie blue staining (lower panel). The purified protein (200 nM) was incubated with His6-IRF3 (200 nM) and varying concentrations of His6-STING(341–379) in the presence of ATP, and then IRF3 dimerization was analyzed by native PAGE. (F) GST-TBK1 or GST (1 μg) was incubated with 2 μg of His6-STING(341–379) and then pulled down with glutathione Sepharose followed by Western blotting analysis. The input represents 10% of the amount of STING used in the pull-down experiments. Data are from a single experiment representative of three independent experiments.

To determine whether NEMO was required for IRF3 activation by STING, we incubated the S20 fraction from wild-type or NEMO-deficient MEFs with His6-STING(341–379) and [35S]-IRF3. We found that the cytosolic extracts from both wild-type and NEMO-deficient MEFs supported IRF3 activation by STING (Fig. 3C), suggesting that NEMO was dispensable for the activation of IRF3 by STING. Furthermore, the increased abundance of STING resulted in activation of a luciferase reporter driven by IFN stimulation regulatory element (ISRE), even in NEMO-deficient MEFs. In contrast, MAVS failed to activate the reporter in the absence of NEMO, but was able to activate the reporter when NEMO was restored (fig. S3). Thus, unlike the MAVS pathway (28), NEMO is not required for IRF3 activation by STING.

To determine the role of TBK1 in the activation of IRF3 by STING, we subjected lysates from HEK 293T cells stably expressing Flag-tagged TBK1 to purification with agarose conjugated to antibody against the Flag tag (M2). This purified TBK1 complex, herein referred to as Flag-TBK1 PD, which contained a small amount of NEMO (Fig. 3A), supported IRF3 dimerization in the presence of His6-STING(341–379) and ATP (Fig. 3D). To examine whether TBK1 alone was required for IRF3 dimerization, we purified glutathione S-transferase (GST)–tagged TBK1 that was expressed in Sf9 cells (Fig. 3E). It was previously shown that TBK1 purified from Sf9 cells phosphorylates IRF3 if used in excess in vitro (29); therefore, we used a limiting amount of TBK1 (200 nM) and titrated the amounts of His6-STING(341–379) that were used in the IRF3 dimerization assay to observe STING-dependent activation of TBK1 (Fig. 3E). GST-TBK1 alone did not induce IRF3 activation; however, in the presence of increasing amounts of His6-STING(341–379), GST-TBK1 caused IRF3 dimerization (Fig. 3E). We also found that GST-TBK1, but not GST alone, bound to His6-STING(341–379) in the GST pull-down assay (Fig. 3F). Together, these results suggest that the C terminus of STING binds to and activates TBK1 to phosphorylate IRF3.

Ser366 and Leu374 of STING are important for the activation of IRF3

Sequence analysis of the STING protein revealed that the C-terminal amino acid residues are conserved across species, suggesting that this region has biological importance (Fig. 4A). To determine the residues of STING(341–379) that were important for IRF3 activation, we constructed a series of STING(341–379) mutants in which the conserved residues were replaced by alanines (V341A and T342A, S358A, Q359A, E360A, S366A, G367A, L374A, R375A, or D377A). We also constructed STING mutants that mimicked phosphorylation of serine residues (S358D and S366D). These mutants were expressed in E. coli, purified, and tested for their ability to activate IRF3 in vitro (Fig. 4A). Two mutations, S366A and L374A, completely abolished IRF3 dimerization, whereas other mutations were largely tolerated (Fig. 4A). Of note, the S358A mutant, which was reported to be functionally defective (19), was partially active in causing IRF3 dimerization in our in vitro assay. The S366D mutant was also largely inactive, which suggested that the functional defect of mutation of the Ser366 residue may not be a result of a phosphorylation defect.

Fig. 4

Ser366 and Leu374 of STING are important for IRF3 activation. (A) Sequence alignment of the C termini of human, mouse, porcine, and bovine STING with ClustalW2. Asterisks indicate residues that were mutated in this study. Wild-type (WT) and mutated STING fragments were expressed in and purified from E. coli as His6-tagged proteins and analyzed by Coomassie blue staining (lower panel). Each protein (2 μM) was tested in an IRF3 dimerization assay (upper panel). Data are from a single experiment representative of three independent experiments. (B) HEK 293T cells were transiently transfected with plasmids encoding full-length STING-Flag (WT) or its mutants (S368A, S366A, and L374A) together with an ISRE-luciferase reporter plasmid (left panel). The error bars represent the variation ranges of duplicate experiments. The presence of STING proteins was confirmed by Western blotting analysis (right panel). (C) L929 cells stably expressing shRNA specific for mouse STING with or without the simultaneous expression of WT or mutant (S358A, S366A, and L374A) human STING-Flag were transfected with ISD for 4 hours. The dimerization of endogenous IRF3 was analyzed by native gel electrophoresis (left panel). The expression of endogenous and reconstituted STING proteins was confirmed by Western blotting (right panel). (D) L929 cells in which endogenous STING was replaced with WT or mutant STING-Flag as shown in (C) were transfected with ISD or mock treated. Membrane pellets (P100) from these cells were incubated with His6-IRF3 in the presence of ATP, and IRF3 dimerization was analyzed by native PAGE (upper panel). Each P100 fraction used in this assay was also analyzed by Western blotting with an antibody against TBK1 (lower panel). Data are representative of at least three independent experiments.

To determine whether Ser358, Ser366, and Leu 374 of STING were important for its function in cells, we transfected HEK 293T cells with plasmid expressing full-length STING containing the point mutations S358A, S366A, and L374A together with the ISRE-luciferase reporter plasmid (Fig. 4B). Whereas wild-type STING activated the ISRE-luciferase reporter, the STING S366A and L374A mutants were completely defective. The S358A mutant exhibited 75% of the activity of the wild-type protein (Fig. 4B). Collectively, these results indicate that residues Ser366 and Leu374 of STING are important for IRF3 activation.

We further investigated the role of C-terminal residues of STING in ISD-induced IRF3 activation by complementation experiments in which endogenous STING in L929 cells was replaced by wild-type or mutant STING proteins. L929 cells stably expressing short hairpin RNA (shRNA) specific for STING or expressing a green fluorescent protein (GFP) control were transfected with ISD for 4 hours, and then cytosolic extracts were prepared to measure IRF3 dimerization (Fig. 4C). We found that RNAi specific for STING abolished ISD-induced IRF3 dimerization, which was rescued by reconstitution with wild-type STING, but not with the S366A or L374A mutant STING proteins. The S358A STING mutant partially rescued IRF3 dimerization in these cells. Consistent with these results, P100 fractions isolated from ISD-stimulated L929 cells expressing wild-type STING or S358A mutant STING caused IRF3 dimerization, whereas those from cells expressing the S366A or L374A mutant STING proteins were inactive (Fig. 4D). These results demonstrate that Ser366 and Leu374 of STING were essential for ISD-induced IRF3 activation in cells.

STING recruits IRF3 to TBK1 to induce IRF3 activation

To explore the mechanism by which IRF3 was activated by wild-type STING and S358A STING, but not by the S366A or L374A mutant STING proteins, we examined the interaction between STING and TBK1 or IRF3 in vitro. We incubated wild-type and mutant GST-STING(341–379), as well as GST alone, with Flag-TBK1 or His6-IRF3, pulled down the tagged proteins with glutathione Sepharose, and analyzed the samples by Western blotting. We found that wild-type STING and all of the mutant STING proteins associated with Flag-TBK1 in vitro (Fig. 5A); however, wild-type and S358A STING, but not S366A or L374A STING, associated with His6-IRF3 (Fig. 5B). Thus, defective binding to IRF3 may underlie the inability of the S366A and L374A mutant STING proteins to promote IRF3 phosphorylation by TBK1.

Fig. 5

STING recruits IRF3 to TBK1 to stimulate IRF3 activation. (A and B) WT or mutant GST-STING(341–379) or GST was incubated with (A) Flag-TBK1 or (B) His6-IRF3 and then pulled down with glutathione Sepharose followed by Western blotting analysis. The input represents 10% of the total amount of TBK1 or IRF3 used in the pull-down experiments. (C) L929 cells stably expressing shRNA specific for STING and those in which endogenous STING was replaced with WT or mutated STING-Flag were stimulated with ISD for the indicated lengths of time. Cell lysates were subjected to immunoprecipitation with anti-Flag–conjugated agarose and then analyzed by Western blotting with the indicated antibodies. Aliquots of the cell lysates were analyzed by Western blotting for the presence of IRF3 after native PAGE (top). (D) Similar to (C), except that cell lysates were resolved by SDS-PAGE, after which they were analyzed by Western blotting with antibodies against TBK1 or TBK1 phosphorylated at Ser172. (E) L929 cells, in which STING or TBK1 was depleted by shRNA, were engineered to express STING-Flag with a lentiviral vector. The cells were transfected with ISD for the indicated lengths of time, and then the STING complex was immunoprecipitated with anti-Flag–conjugated agarose and analyzed by Western blotting with the indicated antibodies. Aliquots of the cell lysates were analyzed by Western blotting with an antibody against IRF3 after native PAGE (top). Data are from a single experiment representative of three independent experiments.

Finally, we examined the interactions between STING, IRF3, and TBK1 in L929 cells in which endogenous STING was replaced with full-length STING proteins that contained different mutations. After stimulation of cells with ISD, wild-type STING and S358A STING interacted with both TBK1 and IRF3 (Fig. 5C). On the other hand, the S366A and L374A mutant STING proteins interacted with TBK1, but not IRF3 (Fig. 5C). These observations were confirmed by immunostaining in cells. Confocal fluorescence microscopy revealed that 2 hours after stimulation with ISD, IRF3 translocated to the nuclei of L929 cells in which endogenous STING was replaced with wild-type STING or S358A STING, but not with S366A or L374A STING. At this time, wild-type and all mutant STING proteins formed punctate-like aggregates at perinuclear regions and colocalized with TBK1 (fig. S4, A and C). These results suggest that IRF3 translocates to the nucleus promptly after phosphorylation by TBK1. To trap the complex containing STING and IRF3, we expressed hemagglutinin (HA)–tagged IRF3 containing the mutations S385A and S386A (2A) by retroviral transduction of L929 cells in which endogenous STING was replaced with wild-type or mutant STING. This mutant did not translocate to the nucleus after ISD stimulation and it appeared to colocalize with wild-type and S358A STING, but not with S366A or L374A STING (fig. S4B). In contrast, the wild-type and all mutant STING proteins appeared to colocalize with TBK1 after stimulation of cells with ISD (fig. S4C).

Consistent with the confocal microscopy data, in cells containing either S366A or L374A STING, ISD induced the phosphorylation of TBK1 at Ser172, a residue that is important for TBK1 activation (Fig. 5D) (30). In contrast, IRF3 dimerization was defective in these cells (Fig. 5C). This uncoupling of TBK1 activation and IRF3 phosphorylation was recapitulated in our in vitro assay, in which wild-type or mutated His6-STING(341–379) proteins were incubated with ATP-supplemented cytosolic extracts from HeLa cells (fig. S5). The wild-type and S358A STING proteins, but not those containing the S366A or L374A mutations, supported IRF3 phosphorylation. On the other hand, all of these proteins stimulated the phosphorylation of TBK1. The inability of the S366A and L374A mutant STING proteins to support IRF3 phosphorylation was not a result of a defect in STING aggregation, because a fraction of these proteins still eluted from the gel filtration column as high–molecular mass species (fig. S6A). Moreover, full-length STING harboring the S366A or L374A mutations still formed punctate-like aggregates in L929 cells stimulated with ISD (fig. S4). Native gel electrophoresis showed that wild-type and all mutant STING proteins formed high–molecular mass aggregates after stimulation of L929 cells with ISD (fig. S6B). Together, these results suggest that the S366A and L374A mutations in STING selectively disrupt its interaction with IRF3, but not TBK1, thereby blocking IRF3 phosphorylation by TBK1.

We found that all of the STING proteins underwent a gel mobility shift after 2 hours of stimulation with ISD (Fig. 5C and fig. S7A). This shift was abolished by treatment with calf intestinal phosphatase (CIP), indicating that phosphorylation of STING caused the mobility shift (fig. S7B). In contrast to the stimulation of cells with ISD, infection of cells with Sendai virus did not cause a detectable mobility shift in STING proteins (fig. S7C). These results suggest that STING is specifically phosphorylated in cells stimulated with ISD. The phosphorylation of STING appeared to precede that of IRF3 (Fig. 5C). Depletion of TBK1 by RNAi prevented the association between STING and IRF3 as well as the phosphorylation of STING (Fig. 5E and fig. S7D). These results suggest that TBK1 phosphorylates STING before it phosphorylates IRF3 and that the phosphorylation of STING might strengthen its interaction with IRF3, which further promotes IRF3 phosphorylation by TBK1.

To map the sites of STING phosphorylation induced by ISD, we stimulated L929 cells in which endogenous STING was replaced with human Flag-tagged STING for 4 hours with ISD, and then we affinity-purified STING protein and analyzed it by tandem mass spectrometry. In addition to the phosphorylation of Ser358, we detected phosphorylation of Ser353 and Ser379 of STING in ISD-stimulated cells (fig. S7E). However, we found no evidence of the phosphorylation of Ser366 in vitro or in cells. Consistent with this result, the S366A STING protein was phosphorylated in cells stimulated with ISD (Fig. 5C). Furthermore, mimicking the phosphorylation of Ser366 with aspartic acid (S366D) did not rescue the activity of STING in vitro (Fig. 4A). Therefore, currently, we have no evidence of the phosphorylation of STING at Ser366. It is possible that similar to the L374A mutation, the S366A mutation impairs the interaction between STING and IRF3, but not TBK1. These mutations uncouple the roles of STING in activating TBK1 and specifying IRF3 phosphorylation, thereby revealing the mechanism by which IRF3 is selectively activated in some but not all pathways that stimulate TBK1 (Fig. 6).

Fig. 6

A model of IRF3 activation by STING. After the detection of cytosolic DNA by a DNA sensor, STING forms oligomers on the ER or other intracellular membranes. The C terminus of STING then recruits IRF3 and TBK1, which facilitates the phosphorylation of IRF3 by TBK1 (left). The mutation of STING at Ser366 or Leu374 does not impair its ability to recruit and activate TBK1, as evidenced by the phosphorylation of TBK1 and STING in ISD-stimulated cells harboring STING proteins with these mutations (right). However, the individual mutations S366A and L374A abolish the interaction between STING and IRF3, thereby preventing IRF3 phosphorylation by TBK1.

Discussion

It is commonly assumed that the activation of a protein kinase is synonymous with the phosphorylation of its substrates. This assumption has been applied to many kinase assays that rely on the detection of activated kinases with phosphospecific antibodies or with surrogate substrates rather than physiological substrates. However, accumulating evidence suggests that the activation of a kinase does not equate to the phosphorylation of a physiological substrate. Recent studies of TBK1 provide a striking example of the uncoupling of protein kinase activation and substrate phosphorylation (30, 31). It is now well established that TBK1 is responsible for the phosphorylation of IRF3 in response to stimulation of several intracellular receptors that induce the production of type I IFNs, including TLR3, TLR4, RIG-I, and MDA5, as well as cytosolic DNA sensors that signal through STING. IRF3 is not activated in inflammatory pathways triggered by other TLRs, such as TLR2 and TLR5, or by receptors for tumor necrosis factor (TNF) or interleukin-1 (IL-1), all of which activate NF-κB. However, TLR ligands and IL-1β activate TBK1, which raises the question of why activated TBK1 does not lead to IRF3 phosphorylation (30, 31). The answer to this question may lie in the fact that signaling pathways that lead to IRF3 activation engage specific adaptor proteins, such as TRIF for TLR3 and TLR4, MAVS for RIG-I and MDA5, and STING for the DNA-sensing pathways.

Through in vitro reconstitution of STING-dependent IRF3 activation, we obtained evidence that may explain why IRF3 is activated in only a subset of pathways that stimulate TBK1. We found that STING bound to both TBK1 and IRF3 and that this binding was mediated through a short C-terminal fragment of STING (Fig. 6). We identified two residues, Ser366 and Leu374, at the C terminus of STING that were dispensable for TBK1 binding and activation but were required for IRF3 binding and phosphorylation. These results indicate that STING not only mediates TBK1 activation but also specifies IRF3 for phosphorylation by TBK1. Although IL-1 and TNF can also stimulate TBK1, these ligands do not activate STING; hence, they do not result in IRF3 phosphorylation. It will be interesting to determine whether other adaptors, such as MAVS and TRIF, also activate IRF3 through the dual mechanism of stimulating the catalytic activity of TBK1 and specifying the phosphorylation of IRF3 by TBK1.

Burdette et al. showed that STING binds directly to cyclic dimeric guanosine monophosphate (GMP) (cyclic-di-GMP), which stimulates the production of type I IFNs (32). A mouse STING mutant protein containing three substitutions at the C terminus, S357A, E359A, and S365A (equivalent to the mutations S358A, E360A, and S366A in human STING), retained less than 10% of the IFN-β–inducing activity of the wild-type protein when it is overexpressed. Furthermore, ectopic expression of this mutant in HEK 293 cells does not confer IFN-β production in response to cyclic-di-GMP. By knocking down endogenous STING in L929 cells and replacing it with human STING, we demonstrated that a single S366A mutation abolished the ability of STING to bind to and activate IRF3 after stimulation with ISD (Fig. 5C).

In our in vitro reconstitution system, only three proteins—TBK1, IRF3, and a C-terminal fragment of STING—were necessary and sufficient for STING-dependent phosphorylation of IRF3. This simple system is in contrast to the MAVS-dependent phosphorylation of IRF3, which requires lysine-63–linked polyubiquitination as well as detection of polyubiquitin chains by NEMO (28). Consistent with this disparity, NEMO is required for the activation of IRF3 by MAVS, but not STING, in cells (fig. S3). Unlike MAVS, which contains several binding sites for TRAF proteins, including TRAF2, TRAF3, and TRAF6, STING contains multiple transmembrane domains but no apparent TRAF-binding motifs. Thus, STING activates TBK1 and promotes IRF3 phosphorylation through a simple mechanism, namely, by directly binding to TBK1 and IRF3. However, our results do not mean that ubiquitination is not involved in the cytosolic DNA signaling pathway. Indeed, it has been reported that TRIM56 ubiquitinates STING to modulate its ability to induce immune responses against intracellular DNA (33). Therefore, it is possible that ubiquitination may control a step upstream of or at the level of STING activation.

The mechanism of STING activation by cytosolic DNA remains to be elucidated. Several DNA sensors have been proposed, including DAI, RNA Pol III, IFI-16, and DDX41 (16). Further genetic studies are required to establish the role of these and other potential DNA sensors in the induction of type I IFN responses (12). In any case, it has been demonstrated that STING is indispensable for IFN production triggered by cytosolic DNA in many cell types, including macrophages (21). Confocal microscopy studies have shown that STING forms punctate-like cytoplasmic structures. Previous studies have demonstrated that the transmembrane domains of STING are essential for it to activate IRF3 and induce IFNs (17, 19). Indeed, DDX41 interacts with STING in the region spanning the second to fourth transmembrane domains of STING (16). We found that the C-terminal fragment of STING containing just 39 amino acid residues was sufficient to support IRF3 phosphorylation by TBK1 in vitro. A fraction of the recombinant STING fragment eluted from the gel filtration column as high–molecular mass species, and only these species were capable of promoting IRF3 phosphorylation by TBK1. Native gel electrophoresis also suggests that endogenous STING forms aggregates after stimulation of cells with ISD. Thus, it is possible that the detection of cytosolic DNA leads to the aggregation and activation of STING on the ER or other membranes, and that the transmembrane domains of STING are required for its aggregation. Because a fraction of the recombinant STING fragment already forms active aggregates, the transmembrane domains are no longer required in the in vitro experiments. This mechanism is analogous to that of the activation of MAVS, which forms large aggregates in response to infection with RNA viruses (34). The mitochondrial transmembrane domain of MAVS is required for it to form these functional aggregates in cells in response to viral infection. In experiments in vitro, however, a mutant MAVS lacking the transmembrane domain is active because a fraction of the recombinant protein already forms high–molecular mass aggregates. The MAVS aggregates are highly potent in activating the IRF3 signaling cascade through a prion-like mechanism (34). Thus far, we have not obtained any evidence that STING forms similar prion-like aggregates in the cytosolic DNA signaling pathway.

Another potential mechanism of STING regulation is suggested by our observation that STING is phosphorylated in response to stimulation by cytosolic DNA. This phosphorylation of STING depends on TBK1. Previous studies have shown that STING is phosphorylated at Ser358 by TBK1 in response to Sendai virus infection (19). Our mass spectrometry analysis confirmed the phosphorylation of STING at Ser358 after stimulation of cells with ISD; however, the mutation of Ser358 to alanine only partially impaired the ability of STING to rescue IRF3 activation in STING-deficient cells. In contrast, the mutation of Ser366 or Leu374 of STING completely abolished the activation of IRF3 by ISD. Although we have not detected STING phosphorylation at Ser366 and cannot rule out a role for the phosphorylation of this residue, STING mutants bearing the S366A or L374A mutation were still phosphorylated in response to ISD stimulation. The phosphorylation of STING and TBK1 in cells containing the S366A or L374A mutants suggests that TBK1 is activated in these cells. Therefore, the S366A and L374A mutations selectively inhibit the phosphorylation of IRF3 by activated TBK1.

Our results not only provide a mechanism for the specific phosphorylation of IRF3 in the cytosolic DNA–sensing pathway but also suggest that it is possible to identify inhibitors that selectively inhibit IRF3 without affecting the phosphorylation of other TBK1 substrates. Such inhibitors may prove useful for treating certain human diseases. For example, mice lacking IRF3 or IFN receptors are resistant to the lethal effects of infection by the bacterium L. monocytogenes or by the parasite Plasmodium falciparum, which causes malaria, the world’s most common infectious disease (12, 35).

Materials and Methods

Reagents and standard methods

The antibody against STING was generated by immunizing rabbits with the recombinant His6-STING(281–379) protein produced in E. coli. This antibody was affinity-purified with a STING antigen column. Antibodies against human IRF3 and NEMO were obtained from Santa Cruz Biotechnology; antibody against the Flag tag (M2), M2-conjugated agarose, and antibodies against the HA tag and tubulin were purchased from Sigma; antibodies against pIRF3 Ser396 and pTBK1 Ser172 were from Cell Signaling; antibodies against mouse IRF3 and GST were obtained from Invitrogen; antibody against TBK1 was from IMGENEX; antibody against TANK was from BioVision; and Texas Red–conjugated antibody against mouse antibody and fluorescein isothiocyanate (FITC)–conjugated antibody against rabbit antibody were obtained from Jackson ImmunoResearch Laboratories. ISD was prepared from equimolar amounts of the sense DNA oligonucleotide TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA and the corresponding antisense oligonucleotide. The oligonucleotides were annealed at 75°C for 30 min before being cooled to room temperature (23). CIP was purchased from New England Biolabs. Other chemicals and reagents were from Sigma unless otherwise specified. Sendai virus (Cantell strain, Charles River Laboratories) was used at a final concentration of 100 hemagglutinating units/ml. The procedures for native gel electrophoresis for the detection of IRF3 dimerization, SDS–polyacrylamide gel electrophoresis (SDS-PAGE), and Western blotting have been described previously (5).

Expression constructs and recombinant proteins

The human STING plasmid, pcDNA3.1-hMPYS-HA, was provided by J. Cambier (National Jewish Medical and Research Center) (18). The complementary DNA (cDNA) encoding STING was subcloned into pcDNA3 (Invitrogen) in-frame with a C-terminal Flag tag for expression in mammalian cells. Various mutants were generated with the QuikChange Site-Directed Mutagenesis Kit (Stratagene). For baculovirus-mediated expression in insect cells, cDNA encoding human STING was inserted into pDEST10 (Invitrogen) in-frame with an N-terminal His6 tag with the gateway system. Human TBK1 was cloned into pDEST20 (Invitrogen) with an N-terminal GST tag. For expression in E. coli, cDNAs encoding the various mutants of human STING were inserted into pDEST17 (Invitrogen) in-frame with an N-terminal His tag or into pDEST15 (Invitrogen) in-frame with an N-terminal GST tag with the gateway system. His6-tagged proteins were purified by nickel affinity chromatography, and GST-tagged proteins were purified by glutathione affinity chromatography. His6-STING(341–379) was further fractionated on a Superdex 200 PC equilibrated with buffer E [20 mM tris-HCl (pH 7.5), 100 mM NaCl, 10% glycerol, 1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride, and 0.5 mM dithiothreitol] with the ETTAN system (GE Healthcare) as previously described (34).

Cell culture, transfections, and luciferase reporter assay

Cells were cultured at 37°C in an atmosphere of 5% (v/v) CO2. HEK 293T, HEK 293T–Flag-TBK1, and L929 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) cosmic calf serum (Hyclone) with penicillin (100 U/ml) and streptomycin (100 mg/ml). RAW 264.7 cells, NEMO-deficient MEFs, and MEFs expressing a Flag-tagged mutant NEMO that lacks the N-terminal 85 residues (Flag-NEMO-ΔN) were cultured in DMEM supplemented with 10% (v/v) fetal bovine serum (Atlanta) and antibiotics. To stimulate with ISD, we transfected L929 cells in 10-cm plates with 25 μg of ISD with Lipofectamine 2000 (Invitrogen). To measure the activity of wild-type or mutant STING proteins, we transfected HEK 293T cells with 1.8 μg of STING cDNA together with 100 ng of ISRE-luciferase reporter and 100 ng of pCMV-LacZ as an internal control by calcium phosphate precipitation. Luciferase activities were measured in duplicate on day 3, as previously described (5).

Purification of TBK1 complexes

To purify endogenous TBK1-containing complexes, we lysed MEFs lacking NEMO or MEFs reconstituted with Flag-NEMO-ΔN in buffer A [10 mM tris-HCl (pH 7.5), 10 mM KCl, 1.5 mM MgCl2, and a protease inhibitor cocktail (Roche)]. After centrifugation at 20,000g for 30 min, the supernatants from both types of cells were mixed at a ratio of 8:1, and the mixture was subjected to immunoprecipitation with M2-conjugated agarose at 4°C for 4 hours. The agarose beads were washed three times with buffer A, and the proteins were eluted with Flag peptide (0.2 mg/ml) in buffer B [50 mM tris-HCl (pH 7.5), 0.1% CHAPS]. The eluted proteins, which contained endogenous TBK1 from MEFs, were stored in buffer C [20 mM tris-HCl (pH 7.5) containing 10% glycerol] after buffer exchange by repeated dilution and concentration. To purify recombinant Flag-TBK1 complex, we prepared cell lysates from HEK 293T cells stably expressing human Flag-TBK1 and performed affinity purification with an antibody against Flag as described earlier.

In vitro assay of STING-dependent IRF3 activation

Biochemical assays for IRF3 activation with cytosolic extracts (S5, S20, and S100) and crude mitochondrial (P5) or ER membrane (P100) fractions of cultured cells were performed as described previously (28). Briefly, cell homogenates in buffer A were centrifuged at 1000g for 5 min to pellet the nuclei. The post-nuclear supernatant was further centrifuged at 5000g for 10 min to separate the mitochondrial fraction (P5) from the cytosolic supernatant (S5). The cytosolic supernatant (S5) was further centrifuged at 100,000g or 20,000g for 30 min to separate the membrane fractions (P100 or P20) from the cytosolic supernatants (S100 or S20). Each 10-μl assay for IRF3 activation contained P5 (or P100), 40 μg of S5 (or S20 or S100), and the indicated recombinant proteins with an ATP buffer [20 mM Hepes-KOH (pH 7.0), 2 mM ATP, 5 mM MgCl2, and 0.25 M d-mannitol]. After incubation at 30°C for 1 hour, the samples were subjected to native gel electrophoresis, and the dimerization of IRF3 was visualized by Western blotting with an antibody against IRF3. For autoradiography, [35S]-IRF3 or the radiolabeled mutant (S385A and S386A; denoted as 2A) was synthesized with the TNT Coupled Reticulocyte Lysate Kit (Promega) supplemented with [35S]methionine. [35S]-IRF3 was mixed with the reaction, and IRF3 was visualized by autoradiography with a PhosphorImager (GE Healthcare).

Lentiviral-mediated RNAi and rescue with transgene

The lentiviral knockdown vector, pTY-shRNA-EF1a-puroR-2a-Flag, was provided by Y. Zhang (University of North Carolina at Chapel Hill) (36). The shRNA sequences were cloned into this vector, which contains the U6 promoter. To rescue the knockdown of mouse STING with human STING, we placed STING cDNA and that of the STING mutants downstream of the puromycin-resistance gene and the foot and mouth disease virus 2A segment, which enables the multicistronic expression of transgenes with a single promoter. After infection with lentivirus, the cells were selected with puromycin (2 μg/ml) to establish cells that stably expressed shRNA. The shRNA sequences are as follows (only the sense strand is shown): STING, 5′-GAGCTTGACTCCAGCGGAA-3′; TBK1, 5′-TCAAGAACTTATCTACGAA-3′.

GST pull-down assays

To analyze binding between STING, TBK1, and IRF3, we incubated a GST-tagged protein with the His6- or Flag-tagged protein in buffer (100 μl) containing 10 mM tris-HCl (pH 7.5), 150 mM NaCl, and 0.1% CHAPS at 4°C for 1 hour. The GST-tagged proteins were then pulled down with glutathione Sepharose, and the bound proteins were analyzed by Western blotting.

Confocal imaging

L929 cells in which endogenous STING was replaced with wild-type or mutated Flag-tagged STING were plated onto coverslips in 24-well plates. On the next day, the cells were transfected with ISD for the indicated times and then were washed with phosphate-buffered saline (PBS) and fixed in 3.7% formaldehyde in PBS for 15 min. Cells were permeabilized and blocked for 30 min at room temperature in a staining buffer containing Triton X-100 (0.2%) and bovine serum albumin (BSA, 3%) and then incubated with an antibody against Flag, IRF3, TBK1, or HA in the staining buffer for 1 hour. After washing three times in the staining buffer, cells were incubated with anti-mouse Texas Red–conjugated antibody against mouse antibody or FITC-conjugated antibody against rabbit antibody for 1 hour. The coverslips, which were washed extensively, were dipped once in water and mounted onto slides with mounting medium [Vectashield with 4′,6-diamidino-2-phenylindole (DAPI); Vector Laboratories]. Imaging of the cells was performed with a Zeiss LSM510 META laser scanning confocal microscopy (Carl Zeiss MicroImaging Inc.).

Supplementary Materials

www.sciencesignaling.org/cgi/content/full/5/214/ra20/DC1

Fig. S1. STING-dependent activation of IRF3 in L929 cells and in a cell-free assay.

Fig. S2. Characterization of the cell-free assay of IRF3 activation by recombinant STING proteins.

Fig. S3. NEMO is dispensable for the activation of IRF3 by STING.

Fig. S4. Confocal fluorescence microscopy of STING, IRF3, and TBK1 in L929 cells.

Fig. S5. Ser366 and Leu374 of STING are required for the phosphorylation of IRF3, but not TBK1, in cell-free assays.

Fig. S6. The S366A and L374A STING mutant proteins still form aggregates.

Fig. S7. STING is phosphorylated by TBK1 upon stimulation of cells with ISD.

References and Notes

Acknowledgments: We thank J. Wu, X. Chen, and C. Long for mapping the STING phosphorylation sites by mass spectrometry. We thank I. Verma (Salk Institute) for providing the NEMO-deficient MEF cells; J. Cambier (National Jewish Medical and Research Center) for pcDNA3.1-hMPYS-HA; and Y. Zhang (University of North Carolina at Chapel Hill) for the pTY lentiviral vector. Funding: This work was supported by grants from NIH (RO1-GM63692), Cancer Prevention and Research Institute of Texas (RP110430), and the Welch Foundation (I-1389). Y.T. was supported by a fellowship from the Sankyo Foundation of Life Science. Z.J.C. is an Investigator of Howard Hughes Medical Institute. Author contributions: Y.T. performed the experiments; Y.T. and Z.J.C. analyzed the data and wrote the paper. Competing interests: The authors declare that they have no competing interests.
View Abstract

Navigate This Article