Research ArticleNeuroscience

Store-Operated Calcium Entry Promotes the Degradation of the Transcription Factor Sp4 in Resting Neurons

See allHide authors and affiliations

Science Signaling  03 Jun 2014:
Vol. 7, Issue 328, pp. ra51
DOI: 10.1126/scisignal.2005242

Abstract

Calcium (Ca2+) signaling activated in response to membrane depolarization regulates neuronal maturation, connectivity, and plasticity. Store-operated Ca2+ entry (SOCE) occurs in response to depletion of Ca2+ from endoplasmic reticulum (ER), mediates refilling of this Ca2+ store, and supports Ca2+ signaling in nonexcitable cells. We report that maximal activation of SOCE occurred in cerebellar granule neurons cultured under resting conditions and that this Ca2+ influx promoted the degradation of transcription factor Sp4, a regulator of neuronal morphogenesis and function. Lowering the concentration of extracellular potassium, a condition that reduces neuronal excitability, stimulated depletion of intracellular Ca2+ stores, resulted in the relocalization of the ER Ca2+ sensor STIM1 into punctate clusters consistent with multimerization and accumulation at junctions between the ER and plasma membrane, and induced a Ca2+ influx with characteristics of SOCE. Compounds that block SOCE prevented the ubiquitylation and degradation of Sp4 in neurons exposed to a low concentration of extracellular potassium. Knockdown of STIM1 blocked degradation of Sp4, whereas expression of constitutively active STIM1 decreased Sp4 abundance under depolarizing conditions. Our findings indicated that, in neurons, SOCE is induced by hyperpolarization, and suggested that this Ca2+ influx pathway is a distinct mechanism for regulating neuronal gene expression.

INTRODUCTION

Ca2+-dependent signaling cascades induced by membrane depolarization regulate gene expression programs essential for the development, function, plasticity, and survival of neurons (1, 2). Discrete Ca2+ influx resulting from activation of glutamatergic receptors, such as the N-methyl-d-aspartate receptor (NMDAR), and activation of voltage-dependent Ca2+ channels (VDCCs) control signaling pathways that regulate the activity of transcription factors, such as adenosine 3′,5′-monophosphate (cAMP) response element–binding protein (CREB) and myocyte enhancer factor-2 (MEF2). In addition to these Ca2+ signals, neurons also have store-operated Ca2+ channels (SOCCs), which mediate Ca2+ influx in response to depletion of Ca2+ from the endoplasmic reticulum (ER). Whether and how the activity of SOCCs contributes to the Ca2+-dependent regulation of transcription factors in neurons are not known.

Depletion of Ca2+ stored in the ER initiates SOCE (also known as capacitative Ca2+ entry). In nonexcitable cells, SOCE not only mediates refilling of Ca2+ stores but also supports Ca2+ signaling pathways important for the regulation of cellular processes, such as exocytosis, proliferation, and gene expression (35). In nonexcitable cells, ER depletion typically occurs in response to ligand-mediated activation of Ca2+ release from the ER. How neuronal activity, which is influenced by the cell’s membrane potential, affects ER depletion and SOCE is unknown. The Ca2+-sensitive protein STIM1 and the Orai channels (also termed CRAC modulators) mediate SOCE (5). The luminal region of STIM1 contains an EF-hand domain, which binds Ca2+ and monitors Ca2+ concentrations in the ER. Association with Ca2+ prevents STIM1 oligomerization. When the ER Ca2+ pool is depleted, STIM1 forms multimers that translocate to junctions where the ER and plasma membrane (PM) are in close proximity; at these junctions, STIM1 multimers associate with Orai channels to initiate SOCE (5). Isoforms of STIM and Orai are present in many regions of the brain, including the cerebellum, cortex, and hippocampus (68). Although SOCE can be triggered in neurons by store depletion agents, such as thapsigargin or cyclopiazonic acid (914), the regulation and signaling effects of this Ca2+ influx in neurons are poorly described.

Transcription factor Sp4 is predominantly found in neurons (15). Sp4 binds to GC-rich DNA sequences, which are recognized as cis-acting elements for the appropriate expression of both tissue-specific genes and housekeeping genes (1618). Sp4 either activates or represses gene transcription in a context- and promoter-specific manner (19, 20). Two observations exemplify the importance of this transcription factor for the maturation and function of the central nervous system: (i) reduced expression of Sp4 interferes with normal dendrite patterning in cerebellar and hippocampal granule neurons (21, 22), and (ii) Sp4 hypomorphic mice exhibit deficits in memory and synaptic plasticity (23, 24). The stability of Sp4 is regulated in response to changes in membrane potential, such that, under resting conditions, Sp4 is rapidly degraded by the ubiquitin-proteasomal system (UPS) (25). Here, we identified STIM1 and SOCCs as mediators of a Ca2+ influx that regulates Sp4 polyubiquitylation and proteasomal degradation in cultured cerebellar granule neurons (CGNs). These findings support the concept that neurons integrate input from both depolarization-induced Ca2+ signals and the graded activation of SOCE to regulate transcription factor activity.

RESULTS

Regulation of Sp4 stability by membrane potential occurs independently from neuronal activity

Altering the PM potential of dissociated neurons in culture by changing the concentration of extracellular potassium ions ([K+]ext) is a well-established method to investigate activity-dependent signaling pathways in neurons (2629). Cultured CGNs have both glutamate receptors, such as NMDARs and VDCCs, that are highly sensitive to the membrane potential and are active under baseline culture conditions of KCl. Reducing the KCl concentration in the culture medium from 25 mM to 5 mM (hyperpolarizing conditions) increases the relative charge of the cytosol to the extracellular space and consequently lowers neuronal activity, whereas increasing the KCl concentration in the culture medium from 5 to 25 mM or to 65 mM (moderate to strong depolarizing conditions) has the opposite effect on the relative charge of the cytosol and results in a greater frequency of action potentials.

Consistent with our previous report (25), we found that decreasing the membrane potential by changing the KCl concentration from 25 to 5 mM reduced the abundance of Sp4 by the UPS in CGNs (Fig. 1, A and B). Furthermore, we found that changing the KCl concentration in the medium from 25 to 65 mM for 60 min to increase the membrane potential and neuronal activity significantly increased the abundance of Sp4 (Fig. 1, C and D) without changing Sp4 mRNA abundance (Fig. 1E).

Fig. 1 Sp4 abundance is regulated by membrane potential and the UPS.

(A) Sp4 polyubiquitylation (Polyub. Sp4) was determined in lysates from CGNs cultured in the presence or absence of the proteasome inhibitor MG132 and either 25 mM KCl (normal culture condition) or after switching to 5 mM KCl for 30 min. Lysates were immunoprecipitated with an antibody recognizing Sp4 and Western-blotted (W) with antibodies recognizing ubiquitin or Sp4 as indicated. (B) CGNs were treated with the 26S proteasome inhibitor MG132 or the calpain inhibitor ALLN, and Sp4 abundance was determined by Western blot. Sp1 was used as a negative control. (C) Western blot analysis of Sp4 from CGNs treated for 60 min with fresh culture medium supplemented with the indicated concentrations of KCl. The band specific to Sp4 (marked by arrowhead) migrates just above the 100-kD marker. (D) Graph shows mean ± SEM (n = 6) Sp4/GAPDH (glyceraldehyde-3-phosphate dehydrogenase) ratio for cells treated as in (C). One-way analysis of variance (ANOVA) revealed a significant difference between KCl groups (F2,15 = 17.69, P < 0.0001). Tukey’s honestly significant difference (HSD) post hoc test: *P < 0.05; ****P < 0.0001. (E) Sp4 mRNA abundance in CGNs treated for 60 min with the indicated concentrations of KCl. Bars represent mean fold change measured by real-time quantitative polymerase chain reaction (qPCR) (error bars indicate range from three biological replicates).

To determine whether membrane channels associated with neuronal activity were involved in promoting Sp4 stability under depolarizing conditions, we evaluated the effect of inhibiting Ca2+ influx mediated by NMDARs, suppressing action potentials by blocking voltage-gated Na+ channels, and blocking Ca2+ entry through VDCCs. Sp4 abundance was reduced to a similar extent in response to hyperpolarizing [K+]ext (5 mM KCl) in the presence or absence of the NMDAR inhibitor MK-801, and the abundance of Sp4 at 25 mM KCl was unchanged by inhibition of NMDARs (Fig. 2, A and B), consistent with our previous report (30). Under depolarizing [K+]ext, Sp4 abundance was unchanged in the presence or absence of tetrodotoxin (TTX) to block voltage-gated Na+ channels (Fig. 2, C and D), suggesting that synaptic activity and action potentials were unnecessary for regulation of Sp4 abundance. In contrast, blocking NMDARs or voltage-gated Na+ channels reduced the abundance of c-Fos, a neuronal activity–regulated transcription factor (1). Further, although we previously reported that a 12-hour exposure to nimodipine to inhibit L-type VDCCs reduced Sp4 abundance in 25 mM KCl (25), here, we found that exposure to nimodipine for 2 hours did not decrease Sp4 abundance under depolarizing conditions when the channels would be active, nor did it affect the reduction in Sp4 abundance observed in 5 mM KCl (Fig. 2, E and F). Finally, simultaneous inhibition of ionotropic glutamate receptors (NMDA and AMPA type) and L-type VDCCs had no effect on Sp4 abundance under depolarizing conditions (fig. S1). The finding that inhibition of NMDARs, voltage-gated Na+ channels, or L-type VDCCs did not mimic the rapid effect of lowering [K+]ext suggested that a pathway distinct from depolarization-induced Ca2+-dependent molecular cascades controls Sp4 stability.

Fig. 2 NMDARs, neuronal activity, and L-type VDCC are not required for regulation of Sp4 abundance by membrane potential.

(A) Western blot of Sp4 abundance in CGNs treated with dimethyl sulfoxide (vehicle) and two concentrations of MK-801 in 5 or 25 mM KCl. c-Fos and P-CREBS133 served as positive controls. (B) Graph shows mean ± SEM Sp4/GAPDH ratio (n = 5). A two-way ANOVA reveals a significant effect of KCl on Sp4 abundance (F1,24 = 50.23, P < 0.0001). The effect of MK-801 is not significant (F2,24 = 0.82, P > 0.05). There is no significant interaction between KCl and MK-801 (F2,24 = 0.11, P > 0.05). Post hoc comparisons between two means were conducted using the Bonferroni correction: ***P < 0.001, ****P < 0.0001. (C) Western blot of Sp4 abundance in depolarized CGNs treated with two different concentrations of TTX for two periods of time. The band specific to Sp4 is indicated with the arrowhead. c-Fos served as a positive control. (D) Graph shows mean ± SEM Sp4/GAPDH ratio (n = 3). A two-way ANOVA shows no significant effect for the concentration factor (F1,8 = 0.12, P > 0.05), the time factor (F1,8 = 0.90, P > 0.05), or the interaction between the two factors (F1,8 = 2.82, P > 0.05). (E) Western blot of Sp4 abundance for control and CGNs treated with nimodipine for 2 hours. P-ERK1/2 (phosphorylated extracellular signal–regulated kinase 1/2) served as a positive control. (F) Graph shows mean ± SEM Sp4/GAPDH ratio (n = 5). A two-way ANOVA reveals a significant effect of KCl on Sp4 abundance (F1,24 = 50.99, P < 0.0001). The effect of nimodipine was not significant (F2,24 = 0.64, P > 0.05), nor was the interaction between KCl and nimodipine (F2,24 = 0.08, P > 0.05). Post hoc comparisons between two means were conducted using the Bonferroni correction: ***P < 0.001, ****P < 0.0001.

The Ca2+ channel inhibitor SKF96365 prevents Sp4 degradation

The canonical transient receptor potential channels (TRPCs) and the SOCCs Orai are two distinct groups of PM channels that can also mediate Ca2+ influx (31, 32). SKF96365 (SKF) is a nonspecific antagonist of TRPCs, SOCCs, and VDCCs (32). We predicted that addition of SKF under depolarizing conditions (25 mM KCl), which blocks Ca2+-dependent regulation of transcription factors such as CREB (33), would have a similar effect as lowering [K+]ext, and reduce Sp4 abundance. Contrary to our expectations, however, we observed that addition of SKF not only increased Sp4 abundance in depolarizing conditions but also completely blocked the reduction in Sp4 abundance in CGNs at rest (5 mM KCl) (Fig. 3, A and B). We obtained a similar result with 2-aminoethoxydiphenyl borate (2-APB) (fig. S2), a chemical unrelated to SKF that antagonizes some TRPCs and SOCCs at the concentration used (34, 35). SKF did not increase Sp4 mRNA abundance (Fig. 3C) but prevented the polyubiquitylation of Sp4 in resting CGNs (Fig. 3D).

Fig. 3 Distinct Ca2+ signals regulate degradation of Sp4 and phosphorylation of CREB.

(A) Western blot analysis of Sp4 abundance in CGNs exposed to the indicated concentrations of SKF or vehicle. Cells were pretreated for 60 min with SKF or vehicle before changing to fresh culture medium with the indicated KCl concentration (supplemented with SKF or vehicle) for an additional 60 min. (B) Graph shows mean ± SEM Sp4/GAPDH ratio (n = 4) for cells treated as in (A). A two-way ANOVA shows a significant effect of KCl (F1,18 = 31.96, P < 0.0001). The effect of SKF is also significant (F2,18 = 17.75, P < 0.0001). Addition of SKF increased Sp4 abundance and eliminated the statistical difference between 25 and 5 mM KCl. The interaction effect between KCl and SKF was not significant (F2,18 = 2.81, P = 0.087). Post hoc comparisons between two means were conducted using the Bonferroni correction: ****P < 0.0001. n.s., not significant. (C) Sp4 mRNA abundance in control and SKF-treated CGNs assessed by real-time qPCR. Bar represents mean fold change (error bar indicates range from three independent replicates). (D) Sp4 was immunoprecipitated from lysates of cells exposed to MG132 or MG132 and SKF as indicated. Immunoprecipitates were analyzed by Western blot with an antibody recognizing ubiquitin to reveal amount of Sp4 polyubiquitylation. (E) Western blot of P-CREB abundance in depolarized CGNs (25 mM KCl) exposed to two concentrations of SKF. (F) Graph shows mean ± SEM P-CREB/CREB ratio (n = 4). One-way ANOVA revealed a significant difference between groups (F2,9 = 27.41, P < 0.0005). Tukey’s HSD post hoc test: *P < 0.05; **P < 0.01, ****P < 0.0001. (G) Western blot of P-CREB abundance in CGNs exposed for 60 min in 5 mM KCl culture medium with different pharmacological inhibitors. The cells were pretreated with their respective inhibitor for 60 min before changing to fresh culture medium supplemented with the pharmacological inhibitor for 60 min. The different compounds and their specific substrates are MK-801 (NMDARs), CNQX (AMPARs), nimodipine (L-type VDCCs), conotoxin and agatoxin mix (P-, Q-, and N-type VDCCs), and SKF (TRPCs, SOCCs, and VDCCs). (H) Graph shows mean ± SEM P-CREB/CREB ratio (n = 4). One-way ANOVA revealed a significant difference between groups (F5,18 = 45.65, P < 0.0001). Tukey’s HSD post hoc test: ****P < 0.0001.

Exposure of CGNs to SKF decreases phosphorylation of CREB at Ser133 (P-CREB), a phosphorylation event associated with CREB activity (33). As a control, we confirmed that SKF decreased CREB phosphorylation. We found that SKF reduced phosphorylation of CREB in 25 mM KCl (Fig. 3, E and F), whereas the abundance of P-CREB in 5 mM KCl culture condition was insensitive to SKF (Fig. 3, G and H). Blocking NMDARs with MK-801 reduced the abundance of P-CREB in 5 mM KCl (Figs. 2A and 3, G and H). Thus, whereas SKF blocked pathways that signal to both CREB and Sp4, an SKF-sensitive pathway in the hyperpolarizing condition regulates only Sp4. We interpreted this finding as an indication that Sp4 polyubiquitylation occurred through an SKF-sensitive pathway that is most active in resting CGNs and that is distinct from the SKF-sensitive pathway that promotes CREB Ser133 phosphorylation under depolarizing conditions.

Proteasomal degradation of Sp4 in resting neurons requires extracellular Ca2+

Because SKF antagonizes PM-localized channels that conduct Ca2+, we examined whether UPS-mediated Sp4 degradation in low [K+]ext depended on Ca2+ influx. Chelating Ca2+ in the culture medium with EGTA before adding the medium to the CGNs prevented Sp4 degradation in 5 mM KCl (Fig. 4, A and B). Addition of EGTA to culture medium supplemented with 25 mM KCl completely blocked depolarization-induced increase in c-Fos abundance but had no effect on the abundance of Sp4 (Fig. 4A). Thus, Sp4 degradation depended on Ca2+ influx that operates in resting neurons and is distinct from depolarization-induced Ca2+-dependent molecular cascades.

Fig. 4 Extracellular Ca2+ is required for hyperpolarization-induced Sp4 degradation.

(A) Western analysis of Sp4 abundance after incubation of CGNs for 60 min in control or EGTA-treated culture medium. Sp1 and c-Fos serve as negative and positive controls, respectively. (B) Graph shows mean ± SEM Sp4/GAPDH ratio (n = 6) of cells treated as in (A). A two-way ANOVA indicates a main significant effect of KCl (F1,20 = 11.12, P < 0.005) and EGTA (F1,20 = 8.06, P < 0.05). The interaction effect between the two factors is significant (F1,20 = 8.23, P < 0.01). Post hoc comparisons between two means were conducted using the Bonferroni correction: **P < 0.01; ***P < 0.001.

Lowering extracellular K+ depletes caffeine-sensitive Ca2+ stores in neurons

Because both SKF and 2-APB antagonize TRPCs and SOCCs, we tested which of these two potential Ca2+ influx mechanisms contributed to the regulation of Sp4 abundance. Under depolarizing conditions, the abundance of Sp4 was unchanged by application of 1-oleoyl-2-acetyl-sn-glycerol (OAG), an agonist of several TRPCs (fig. S3). Those data and the fact that most TRPCs are nonselective Na+ and Ca2+ channels that cause membrane depolarization (31) indicated that TRPCs were unlikely to be responsible for the decrease in Sp4 abundance in resting neurons.

Because SOCE is initiated by the depletion of Ca2+ stored in the ER, we reasoned that if SOCE regulates Sp4 stability, then the quantity of Ca2+ in intracellular pools should rapidly decrease when CGNs are switched from depolarizing to resting culture conditions. To test this hypothesis, we imaged cytosolic Ca2+ in response to changes in [K+]ext in the presence or absence of caffeine to induce Ca2+ release from intracellular pools through the activation of ryanodine receptors (36, 37).

We applied caffeine to CGNs in 65 mM KCl imaging solution and observed a sharp, pronounced Ca2+ transient (Fig. 5A). Exposure of CGNs in 25 mM KCl imaging solution with caffeine also produced a Ca2+ transient (Fig. 5B), but the average amplitude of the Ca2+ release in this condition was significantly smaller than the one observed in the 65 mM KCl imaging solution (Fig. 5C). Together, these results confirmed the presence of caffeine-sensitive Ca2+ stores in depolarized CGNs. To extend the observation that the amount of Ca2+ within the intracellular stores varied in response to [K+]ext, we then repeated this experiment with CGNs placed in 5 mM KCl imaging solution and monitored Ca2+ transients after the addition of caffeine at two time points, 7 and 60 min, after changing to the 5 mM KCl imaging solution. With this experimental strategy, we detected a caffeine-induced Ca2+ transient shortly after switching to the 5 mM KCl solution (Fig. 5D), but the effect of caffeine was lost when the cells were incubated in low KCl for 60 min before the addition of caffeine (Fig. 5E). These results indicated that caffeine-sensitive pools became gradually depleted when CGNs were switched from depolarizing to resting culture conditions. When the resting CGNs that were unresponsive to caffeine were briefly (5 min) depolarized with 65 mM KCl solution and then were returned to the 5 mM KCl solution, the cells again produced a Ca2+ transient in response to caffeine, indicating that the intracellular Ca2+ stores were rapidly replenished (Fig. 5E). These experiments corroborate previously published observations of caffeine-induced Ca2+ release in dissociated neuronal cultures (3840) and indicate that membrane depolarization influences Ca2+ stores such that in low [K+]ext, intracellular Ca2+ pools become depleted.

Fig. 5 Depletion of caffeine-sensitive intracellular Ca2+ stores in resting CGNs.

(A and B) CGNs loaded with Fluo-4 and incubated in 65 mM KCl (A) or 25 mM KCl (B) imaging solution were stimulated with caffeine (50 mM) for the period indicated (gray box) to release Ca2+ from intracellular pools. In both (A) and (B) experiments, cells were switched to 5 mM KCl solution to establish F/F0 = 1. (C) The amount of Ca2+ released by the application of caffeine was quantified as the difference between F/F0 [CAF peak] and F/F0 [baseline] [as indicated in (B)]. Data from each biological replicate are presented, and the horizontal bars represent the mean ± SEM for each condition. *P < 0.05, two-tailed t test. (D) CGNs loaded with Fluo-4 as in (A) were preincubated in 65 mM KCl for 5 min, then switched to equiosmotic 5 mM KCl imaging solution, and stimulated with caffeine 7 min later. (E) The experiment was repeated exactly as in (D), but the cells were incubated in the 5 mM KCl solution 60 min before caffeine stimulation. In both (D) and (E) experiments, the cells were depolarized with 65 mM KCl solution after the initial caffeine stimulation to demonstrate cellular responsiveness and to show the rapid replenishment of intracellular pools (E). All results are expressed as F/F0 and were replicated in at least three biological replicates. Traces are the average of 72 (A), 60 (B), 68 (D), and 66 (E) individual cells from one biological replicate. The gray outlines represent ±SEM for each measured time point.

Sustained SOCE occurs in resting neurons

We investigated whether the rapid and persistent depletion of Ca2+ stores in resting CGNs was accompanied by the activation of a Ca2+ influx consistent with SOCE. To test this hypothesis, we removed extracellular Ca2+ during the preimaging period and added a cocktail of inhibitors to block any Ca2+ influx from ionotropic glutamate receptors (NMDA and AMPA) and L-type VDCCs and then imaged Ca2+ transients in 5 mM KCl imaging solution upon the addition of Ca2+. Under these conditions, we detected a sustained Ca2+ influx shortly after the addition of extracellular Ca2+ to the imaging solution (Fig. 6 and movie S1), and the presence of SKF prevented this Ca2+ influx (Fig. 6 and movie S2). Although the averaged increase in signal intensity for this SKF-sensitive Ca2+ influx was small (F/F0 = ~+0.3), this result is consistent with previous measures of SOCE in other cell types because these channels exhibit very low but highly selective conductance for Ca2+ (41). Finally, taking these data together with our findings that SKF or the chelation of extracellular Ca2+ with EGTA prevented hyperpolarization-induced Sp4 degradation, we propose that this SOCE-mediated Ca2+ influx is a key component in the regulation of Sp4 by the UPS.

Fig. 6 Induction of a Ca2+ influx consistent with SOCE in resting CGNs.

CGNs (DIV4) loaded with Fluo-4 were preincubated for 60 min in 5 mM KCl imaging solution without Ca2+ and supplemented with a cocktail of inhibitors [dl-2-amino-5-phosphonopentanoic acid (APV), 100 μM; CNQX, 4 μM; nimodipine, 20 μM] with or without SKF (30 μM). The inhibitors were included to maximize the detection of current mediated by SOCE. After beginning the imaging session, the preincubation solution was replaced by fresh equiosmotic 5 mM KCl imaging solution with the indicated inhibitors and 2 mM Ca2+ to reveal SOCE in resting CGNs (see movies S1 and S2 for video of Ca2+ influx under these conditions). Traces are the average of 104 (control) and 94 (SKF) individual cells from three independent biological replicates. The gray outlines represent ±SEM for each measured time point.

Changes in extracellular K+ concentration rapidly modify STIM1 distribution in dissociated neurons

Depletion of Ca2+ from the ER in nonexcitable cells promotes STIM1 oligomerization, a required step for the association of STIM1 with SOCCs at ER-PM junctions and the initiation of SOCE (5). We therefore examined whether modifying the [K+]ext altered the distribution of STIM1 in CGNs by expressing full-length yellow fluorescent protein (YFP)–tagged STIM1 and monitoring the YFP signal with live cell imaging. Because highly overexpressed STIM1 can promote the nonphysiological and constitutive oligomerization of STIM1 (32), we used the lowest detectable amount of YFP-STIM1 for these experiments. The transfected CGNs displayed diffuse YFP-STIM1 fluorescence when the cells were depolarized with 65 mM KCl solution (Fig. 7A). However, when the KCl concentration in the imaging solution was reduced from 65 to 5 mM, we observed redistribution of YFP-STIM1 fluorescence into puncta around the cell body, along the axon, and on fine processes within 30 min (Fig. 7B). Quantification of the number of YFP-STIM1 puncta along neurites and around cell bodies of live CGNs revealed a significant difference between resting membrane potential (5 mM KCl) and the conditions of moderate (25 mM KCl) and strong (65 mM KCl) depolarization (Fig. 7, C and D). These findings were consistent with the formation of STIM1 multimers and their relocalization to ER-PM junctions in resting conditions. Within 5 min of switching the cells from 5 to 65 mM KCl solution, the STIM1 localization pattern became diffuse (fig. S4). This rapid redistribution of STIM1 after transfer into depolarizing conditions is consistent with our finding that caffeine-sensitive Ca2+ stores refilled within the same timeframe (Fig. 5E). Western blot analysis of CGNs revealed that STIM1 was abundant, whereas STIM2 was almost undetectable (fig. S5A). Furthermore, YFP-STIM2 did not form puncta like STIM1 when the KCl concentration in the imaging solution was lowered from 65 to 5 mM (fig. S5, B and C).

Fig. 7 Changes in membrane potential induce dynamic relocalization of STIM1 in primary CGNs.

(A and B) YFP-STIM1 fluorescence from a transfected CGN was imaged in real time first when the cell was in 65 mM KCl imaging solution (A) and then 30 min later after changing to an equiosmotic 5 mM KCl imaging solution (B; a representative cell is shown). Arrowheads in each panel correspond to the same region. The lower panels are high magnification of a 20-μm neurite region from the corresponding upper panels. (C and D) Quantification of number of YFP-STIM1 puncta along neurites (C) and cell bodies (D) of live CGNs when the cells were incubated in imaging solution with the indicated concentration of extracellular KCl. One-way ANOVA revealed a significant difference between KCl groups for the quantification of puncta along neurites (F2,108 = 84.32, P < 0.0001) and cell bodies (F2,84 = 29.46, P < 0.0001). Tukey’s HSD post hoc test: ****P < 0.0001. Note that we applied a stringent threshold to isolate the YFP-STIM1 puncta from the background. This manipulation likely prevented puncta with weaker fluorescence intensity from being counted, particularly in neurites. (E and F) Real-time imaging of a CGN expressing the mutant YFP-STIM1D76A exposed first to 65 mM (E) and then to 5 mM (F) KCl imaging solution. Arrowheads in the corresponding upper and lower panels indicate the same position. (G to I) CGNs cotransfected with YFP-STIM1 and Orai-His were fixed and imaged with an antibody recognizing green fluorescent protein (GFP) (G, to visualize YFP-STIM1) and an antibody recognizing the His tag (H). The merged captures are presented in (I). Arrowheads indicate the exact same position in each panel. Scale bar, 20 μm.

To confirm that the relocalization of STIM1 in response to changes in [K+]ext was mediated by changes in luminal Ca2+, we repeated this experiment with mutant YFP-STIM1D76A. The D76A mutation prevents Ca2+ binding to the luminal EF-hand domain of STIM1, thereby constitutively activating SOCE (42). In contrast to wild-type STIM1, YFP-STIM1D76A was localized in puncta in either 5 or 65 mM KCl conditions (Fig. 7, E and F). This result suggested that association of Ca2+ with the luminal EF-hand domain of STIM1 limits the oligomerization process in CGNs. Activation of SOCE involves the recruitment of Orai channels by STIM1 multimers (5); therefore, we examined the distribution of coexpressed Orai channels under resting conditions. Either His-tagged Orai1 (Fig. 7, G to I) or His-tagged Orai2 (fig. S6) formed clusters that were closely juxtaposed to YFP-STIM1 puncta in CGNs in 5 mM KCl condition. This close association of YFP-STIM1 multimers and His-tagged Orai channels in CGNs is comparable to that observed in nonexcitable cells (43, 44).

STIM1 abundance and function affect Sp4 abundance

Because the SOCC inhibitor SKF blocked polyubiquitylation and degradation of Sp4 under culture conditions that correlated with depletion of Ca2+ stores and formation of STIM1 puncta, we investigated whether STIM1 activity contributed to the regulation of Sp4 abundance. We knocked down endogenous STIM1 in CGNs with a short hairpin RNA (shRNA) validated in Neuro2A cells (Fig. 8A). CGNs were cotransfected with plasmids encoding GFP, FLAG-Sp4, and either the STIM1 shRNA or vector, and FLAG-Sp4 immunofluorescence was quantified after exposure of the cells for 60 min to fresh culture medium supplemented with 65 or 5 mM KCl. Cells transfected with the control vector displayed significantly less FLAG immunofluorescence in the 5 mM KCl condition than in the 65 mM KCl condition, indicating that, similar to endogenous Sp4, the abundance of FLAG-tagged Sp4 was regulated by [K+]ext (Fig. 8B). CGNs transfected with the STIM1 shRNA had significantly more FLAG immunofluorescence than control cells in 5 mM KCl (Fig. 8B).

Fig. 8 STIM1 regulates Sp4 abundance.

(A) Lysates from Neuro2A cells transfected with STIM1 shRNA or control shRNA were analyzed by Western blot with the indicated antibodies. Cells were cotransfected with a plasmid expressing GFP as a control for transfection efficiency. Data are representative of experiments performed in triplicate. (B) Quantification of FLAG immunofluorescence in dissociated CGNs cotransfected with FLAG-Sp4 and shRNA vector and exposed for 60 min to culture medium with either 65 mM KCl (n = 131) or 5 mM KCl (n = 141). FLAG immunofluorescence was also quantified in CGNs transfected with FLAG-Sp4 and STIM1 shRNA and exposed for 60 min to 5 mM KCl (n = 83). One-way ANOVA revealed a significant difference between groups (F2,352 = 39.02, P < 0.0001). Tukey’s HSD post hoc test: ****P < 0.0001. (C and D) Representative immunostaining of FLAG-Sp4 cotransfected with wild-type YFP-STIM1 (C) or mutant YFP-STIM1D76A (D) in CGNs. Arrowheads indicate the same position in each panel. Scale bar, 20 μm. (E) Contingency table summarizing the number of FLAG immunopositive and immunonegative nuclei counted in dissociated CGN cultures cotransfected with FLAG-Sp4 and human YFP-STIM1 or constitutively active YFP-STIM1D76A. (F) Quantification of FLAG immunofluorescence in the immunopositive FLAG-Sp4 nuclei cotransfected with either YFP-STIM1 (n = 57) or constitutively active YFP-STIM1D76A (n = 30). **P < 0.01, two-tailed t test.

We also examined the effect of the wild-type YFP-STIM1 or the constitutively active YFP-STIM1D76A mutant on the abundance of FLAG-tagged Sp4. Even in the strong depolarizing condition (65 mM KCl), in which endogenous Sp4 would be stable and abundant, neurons transfected with YFP-STIM1D76A were less likely than neurons transfected with YFP-STIM1 to display immunopositive nuclei with FLAG-Sp4 (Fig. 8, C to E). Furthermore, those neurons transfected with YFP-STIM1D76A in which FLAG-Sp4 was detected had significantly reduced immunofluorescence intensity than the neurons transfected with YFP-STIM1 (Fig. 8F). We demonstrated the specificity of the dependence on STIM1 for Sp4 degradation by performing a similar analysis with the related transcription factor Sp1, the abundance of which was not altered by changing [K+]ext (Fig. 1, B and C). The abundance of endogenous Sp1 and the number of positive nuclei were the same in CGNs exposed to 65 mM KCl and coexpressing either YFP-STIM1D76A or YFP-STIM1 (fig. S7). Thus, we propose that constitutively active STIM1D76A in depolarized CGNs mimicked the effect of low [K+]ext to reduce Sp4 abundance by engaging SOCE, leading to a Ca2+ influx that activated the downstream signaling pathway responsible for the regulation of Sp4 by the UPS.

DISCUSSION

The data presented here reveal a surprising connection between the low [K+]ext condition that favors a resting PM potential, the depletion of intracellular Ca2+ stores, the induction of STIM1-mediated SOCE in dissociated CGNs, and Sp4 transcription factor abundance (fig. S8). We showed that this Ca2+ influx regulates transcription factor Sp4 by promoting its polyubiquitylation and proteasomal degradation in a manner that is distinct and separate from well-known depolarization-induced Ca2+ pathways. Together, our findings reveal exciting new details about how Ca2+ signaling operates in neurons, and add an unsuspected dimension to our understanding of Ca2+-mediated transcription in these cells.

SOCE is a major pathway by which extracellular Ca2+ enters nonexcitable cells (3). Excitable cells, like neurons, have many different Ca2+-permeable channels, such as ionotropic glutamatergic receptors and voltage-gated ion channels, and the contribution of SOCE to the net pattern of ionic conductance is not well described for these cells. Although a function for this specific mode of Ca2+ influx in the nervous system has been an intriguing question (45), and the key components of SOCE are present in the brain (68), efforts to confirm operation of neuronal SOCE remain limited (36). Most studies reporting evidence for SOCE in the nervous system have relied on the use of pharmacological agents to deplete internal Ca2+ stores (914).

In cultured CGNs, we observed depletion of caffeine-sensitive Ca2+ stores, induction of an SKF-sensitive Ca2+ influx comparable in intensity to SOCE, and rapid and reversible formation of STIM1 puncta in CGNs by decreasing [K+]ext to concentrations that produce a resting membrane potential. Thus, activation of this Ca2+ influx pathway in dissociated neuronal cultures may be inversely related to the amount of membrane depolarization. Consistent with this scenario, Usachev and Thayer have reported that a Ca2+ influx induced by store depletion and insensitive to antagonists of VDCCs was facilitated by hyperpolarizing the membrane of rat dorsal root ganglion cells (46). In addition, hyperpolarization-induced STIM- and Orai-mediated SOCE has been described in human myoblasts, where it is required for the Ca2+-dependent differentiation of these excitable cells into multinucleated myotubes (47, 48). Finally, the ER in primary neuronal cultures and organotypic slice cultures may be fully or partially depleted under resting conditions (36, 49), a characteristic that we observed for dissociated CGNs in this study. Thus, hyperpolarization-induced SOCE is likely a fundamental characteristic that is shared by many excitable cells, including neurons.

Studies in nonexcitable cells support both overlapping and unique functions for the STIM1 and STIM2 homologs. The relative contributions of STIM1 and STIM2 in neurons are not clear, and each has been suggested to be the primary regulator of SOCE in neurons (50, 51). Our study indicated that changes in membrane depolarization rapidly altered the concentration of intracellular Ca2+ pools and influenced the activity of SOCE in dissociated neurons. Thus, membrane potential should be taken into account in studies of neuronal SOCE. We also observed that STIM1 was much more abundant than STIM2 in primary CGNs (fig. S5A), whereas both STIM1 and STIM2 were abundant in Neuro2A neuroblastoma cells (Fig. 8A). Furthermore, YFP-STIM2 did not form puncta under conditions that consistently resulted in clear, distinct YFP-STIM1 puncta in CGNs (fig. S5, B and C). These data suggest that the relative abundance of STIM1 and STIM2 may vary by neuronal cell type and that, even when both are present, the proteins may have distinct regulation and function. Our data suggested that in CGNs, STIM1 is the primary STIM protein contributing to SOCE in response to changes in membrane potential.

STIM-dependent and SOCE-mediated regulation of transcription factors has been reported in several studies. For instance, in T lymphocytes, SOCE promotes the expression of nuclear factor of activated T cells (NFAT) target genes through activation of the Ca2+-dependent phosphatase calcineurin, which increases the nuclear accumulation of NFAT (52). In SH-SY5H neuroblastoma cells, muscarinic acetylcholine receptor activity induces SOCE, which then enhances the activity of the transcription factor nuclear factor κB (NF-κB) (53). Finally, the interaction of STIM1 with SOCCs promotes cAMP accumulation and protein kinase A (PKA) activation in an epithelial cell line (54), which may connect SOCE to control of the activity of PKA-regulated transcription factors (55). Here, we identified Sp4 as regulated by SOCE. Additionally, our study revealed that SOCE is regulated in response to changes in membrane potential in neurons. Together, these studies offer candidate signaling pathways that could participate in the SOCE-dependent regulation of Sp4 and open up the possibility that other transcription factors may be regulated by SOCE in resting neurons.

Our study suggested that the abundance of Sp4 varied with PM potential with the lowest abundance correlating with conditions in which SOCE would be most active, the resting membrane potential. This introduces a new variable to consider when thinking about how Ca2+ signaling participates in the control of gene expression in neurons. Considerable efforts have been focused on understanding how Ca2+ influx, resulting from glutamatergic neurotransmission, neuronal activity, and membrane depolarization, influences the activity of transcription factors, such as CREB and MEF2 (1, 2, 56). Although the spatiotemporal characteristics of different Ca2+ signals play key roles in engaging one molecular cascade over another (57, 58), most studies have presented the regulation of Ca2+-dependent transcription factors as occurring in a temporally constrained and largely ON and OFF manner in response to PM depolarization. Our results, indicating that the abundance of Sp4 was correlated with membrane potential in a graded fashion, challenge this view of ON and OFF Ca2+-mediated regulation of transcription factor activity in neuronal cells. We propose that graded abundance of Sp4 reflects graded activation of SOCE by the membrane potential, such that as membrane potential is reduced, more Ca2+ release from the ER occurs, depleting the stores further and stimulating more SOCE. This putative graded SOCE may provide analog control over transcription. Thus, our data showed that Ca2+ signaling not only controls depolarization-induced transcription factor activity but also actively controls transcription factor activity under nondepolarizing conditions through SOCE. This adds to the complexity in how Ca2+ signaling in neurons regulates specific programs of gene expression, enabling these cells to respond and adapt to changes in their extracellular environment.

Deficiencies in STIM1 and Orai channels that cause aberrant SOCE contribute to the pathophysiology of cardiovascular, pulmonary, and autoimmune disorders (59, 60). Dysregulation of Ca2+ homeostasis likely also has a central role in the etiology of neurodegenerative disorders (61, 62) and may be a feature that is common to several psychiatric disorders (63). Although previous studies have examined SOCE in neurons under pathological conditions linked to Alzheimer’s disease (64, 65), Huntington’s disease (66), or damaged sensory neurons (67), the link between this specific Ca2+ pathway and brain disorders remains elusive because it is not clear under what physiological conditions neuronal SOCE functions. Our study offers a way of thinking about neuronal SOCE that may provide insights into dysregulation of Ca2+ homeostasis associated with certain brain disorders. For example, genetic variations in Sp4 have been associated with schizophrenia and bipolar disorder (24, 68, 69), and we have reported that Sp4 protein, but not mRNA, abundance in the cerebellum and prefrontal cortex was reduced in postmortem bipolar disorder subjects and inversely correlated with negative symptoms in schizophrenia (25, 70). Our current results suggest that dysregulation of upstream signaling potentially controlled by STIM1-mediated SOCE may play a role in the aberrant abundance of Sp4 and contribute to the etiology of these affective disorders.

MATERIALS AND METHODS

Cell culture and transfection

Primary granule neurons were obtained from dissociated cerebella of 6-day-old Long Evans rat pups as described (71). All animal work was approved by Tufts University Institutional Animal Care and Use Committee and carried out in accordance with institutional guidelines. The isolated cells were resuspended in basal medium Eagle supplemented with 10% FetalClone II (HyClone), 20 mM KCl (25 mM final concentration), 2 mM glutamine, penicillin (50 U/ml), and streptomycin (50 μg/ml). Cells were seeded in 12- or 6-well dishes coated with poly-d-lysine (Sigma-Aldrich) at a density of 1.0 × 106 or 3.0 × 106 cells per well, respectively. Cytosine arabinofuranoside (AraC, 10 μM) was added to the culture medium 18 to 24 hours after plating. Unless indicated otherwise, cultures were maintained for 6 to 10 days before experimental treatments and cell harvesting. For experiments involving pharmacological inhibitors, the cells were typically pretreated for 60 min with the compound before incubating them with fresh culture medium supplemented with the same pharmacological agent.

Dissociated CGNs were transfected at day in vitro 2 (DIV2) by Ca2+ phosphate precipitation. For each transfection, culture medium was replaced with warm Dulbecco’s modified Eagle’s medium (DMEM), and then the DNA-Ca2+ phosphate precipitate was added to the cells for 20 min. Cells were then washed twice with warm DMEM, and fresh culture medium supplemented with AraC was added to each well. For STIM1 knockdown experiments, cells transfected on DIV2 were analyzed on DIV5. For experiments comparing the effect of YFP-STIM1 and constitutively active YFP-STIMD76A coexpression on FLAG-Sp4 protein abundance, cells were transfected on DIV2 and analyzed on DIV4.

Neuro2A cells were cultured in DMEM [supplemented with 10% FetalClone II (HyClone), penicillin (50 U/ml), and streptomycin (50 μg/ml)] and transfected overnight using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. Transfected cells were selected with puromycin (4 μg/ml) for 48 hours.

Antibodies and pharmacological compounds

The antibodies recognizing Sp4 (sc-645), CREB (sc-186), ubiquitin (sc-8017), or ERK2 (sc-1647), and the horseradish peroxidase–conjugated secondary antibodies were from Santa Cruz Biotechnology. The antibodies recognizing P-CREBSer133 (#9198), phosphorylated ERK1/2Thr202/Tyr204 (#4370), c-Fos (#2250), STIM1 (#4916), or STIM2 (#4917) were from Cell Signaling Technology. The antibodies recognizing GAPDH (MAB374) or Sp1 (#07-645) were from Millipore Corp. The antibody recognizing 6× His (ab18184) was purchased from Abcam; the antibody recognizing GFP (A10262), which was used to detect YFP, was from Invitrogen; and the M2 mouse antibody recognizing FLAG (F1804) was from Sigma-Aldrich.

MK-801, nimodipine, CNQX, EGTA, SKF96365, OAG, and caffeine were from Sigma-Aldrich. MG132, ALLN, and 2-APB were from EMD Biosciences. ω-Conotoxin GVIA and ω-agatoxin IVA were from Peptide Institute Inc. TTX and APV were from Tocris Bioscience.

Plasmids

The full-length 3× FLAG-tagged human Sp4 was described before (21). The following plasmids were purchased from Addgene: pEX-CMV-SP-YFP-STIM1 (plasmid 18857) and pEX-CMV-SP-YFP-STIM1D76A (plasmid 18859) were initially described in (42), pEX-CMV-SP-YFP-STIM2 (plasmid 18862) was first presented in (72), and pcDNA 3.1-Orai1-Myc-His (plasmid 21638) and pcDNA 3.1-Orai2-Myc-His (plasmid 16369) were described in (7).

The pLKO.1-puro control vector (SHC001) and the pLKO.1-puro STIM1 (TRCN0000175008) shRNA were purchased from Sigma-Aldrich. The sequence targeted by the STIM1 shRNA corresponded to mouse STIM1 nucleotides 1668 to 1688 [gcagtactacaacatcaagaa; National Center for Biotechnology Information (NCBI) Reference Sequence: NM_009287], which has 100% homology with the rat sequence (NCBI Reference Sequence: NM_001108496).

Western blotting

For Western blot analyses, cells were collected by scraping in ice-cold radioimmunoprecipitation assay buffer [50 mM tris-HCl (pH 8.0), 300 mM NaCl, 0.5% Igepal-630, 0.5% deoxycholic acid, 0.1% SDS, 1 mM EDTA] supplemented with a cocktail of protease inhibitors (Complete Protease Inhibitor without EDTA, Roche Applied Science) and phosphatase inhibitors (Phosphatase Inhibitor Cocktail A, Santa Cruz Biotechnology). One volume of 2× Laemmli buffer [100 mM tris-HCl (pH 6.8), 4% SDS, 0.15% bromophenol blue, 20% glycerol, 200 mM β-mercaptoethanol] was added, and the extracts were boiled for 5 min. Samples were adjusted to an equal concentration after protein concentrations were determined using the Bio-Rad Protein Assay.

Lysates were separated using SDS–PAGE (polyacrylamide gel electrophoresis) and transferred to a nitrocellulose membrane. After transfer, the membrane was blocked in TBST (tris-buffered saline and 0.1% Tween 20) supplemented with 5% nonfat powdered milk and probed with the indicated primary antibody at 4°C overnight. After washing with TBST, the membrane was incubated with the appropriate secondary antibody and visualized using ECL (enhanced chemiluminescence) reagents according to the manufacturer’s guidelines (Pierce, Thermo Fisher Scientific).

The following procedure was used to quantify Western blots. First, equal quantity of protein lysate was analyzed by SDS-PAGE for each biological replicate. Second, the exposure time of the film to ECL was the same for each biological replicate. Third, all the exposed films were scanned on an Epson Perfection V500 Photo Scanner in grayscale at a resolution of 300 dots per inch. Fourth, the look-up table of the scanned tiff images was inverted, and the intensity of each band was individually estimated using the selection tool and the histogram function in Adobe Photoshop CS 8.0 software. Finally, the intensity of each band was divided by the intensity of its respective loading control (GAPDH) to provide the normalized value used for statistical analysis.

Detection of polyubiquitylated Sp4

To assess polyubiquitylation of Sp4 in DIV10 CGNs, Sp4 was immunopurified from the nuclear fraction using rabbit agarose-conjugated polyclonal antibody recognizing Sp4 (Santa Cruz Biotechnology). Immunopurified material was separated using SDS-PAGE and electrophoretically transferred to a nitrocellulose membrane. To enhance the immunodetection of ubiquitin conjugated to Sp4, the nitrocellulose membrane was placed between two layers of Whatman filter paper, submerged in distilled water, and autoclaved for 30 min. After autoclaving, the membrane was blocked in blocking solution (TBST supplemented with 5% milk) for 30 min and incubated overnight with an antibody recognizing ubiquitin (Santa Cruz Biotechnology, clone P4D1, 1:200) in blocking solution. Subsequent steps were carried out according to the Western blot procedure described above.

Real-time reverse transcription PCR

After experimental treatment, total RNA was isolated from CGNs cells using the TRIzol method (Invitrogen). The concentration of total RNA was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific), and first-strand complementary DNA (cDNA) was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad). Real-time PCRs were performed using gene-specific primers and monitored by quantification of SYBR Green I fluorescence using a Bio-Rad CFX96 Real-Time Detection System. Expression was normalized against gapdh expression. The relative quantification from three biological replicates was performed using the comparative cycle threshold (ΔΔCT) method.

Primers for real-time reverse transcription PCR are as follows: Sp4, 5′-AGCGATCAGAAGAAGGAGGAG-3′ (forward) and 5′-GTTGCTTGATTTTCACCAGGA-3′ (reverse); GAPDH, 5′-ATGACCACAGTCCATGCCATC-3′ (forward) and 5′-CCAGTGGATGCAGGGATGATGTTC-3′ (reverse).

Calcium measurements

For Ca2+ imaging experiments, CGNs were seeded on poly-d-lysine–coated 35-mm glass bottom multiwell culture plates (MatTek Corp.). The cells were loaded with the fluorescent Ca2+ indicator Fluo-4 by incubation in 25 mM KCl imaging solution [10 mM Hepes (pH 7.3), 120 mM NaCl, 1 mM MgCl2, 2 mM CaCl2, 10 mM glucose] containing 2 μM acetoxymethyl ester of the dye (Fluo-4 AM; Invitrogen, Molecular Probes) for 45 min at room temperature. After loading, cells were washed three times with Hepes imaging solution supplemented with 65, 25, or 5 mM KCl according to the experiment and incubated for 30 to 60 min at room temperature to allow de-esterification of the dye. NaCl concentration was adjusted to control for the osmotic balance between the imaging solutions with different KCl concentrations. For imaging solution in which CaCl2 was omitted, the concentration of MgCl2 was increased accordingly to maintain osmotic balance. Data collection, image processing, and analyses were carried out with SlideBook (Intelligent Imaging Innovations), ImageJ [National Institutes of Health (NIH)], and Microsoft Excel. Fluo-4 fluorescent signal in all experiments was quantified at the level of the cell body.

Live cell imaging and YFP-STIM1 puncta quantification

Dissociated CGNs cultured on poly-d-lysine–coated 35-mm glass bottom multiwell culture plates (MatTek Corp.) were transfected at DIV2 with 0.25 μg of DNA plasmid using the Ca2+ phosphate technique. Two days after transfection, the cells were washed three times with Hepes imaging solution supplemented with 65 mM KCl and incubated for 10 min before beginning the imaging session to stabilize the cells to the stage temperature (37°C). NaCl concentration between the different imaging solutions (65, 25, and 5 mM KCl) was adjusted to control the osmotic balance.

Quantification of YFP-STIM1 puncta was performed according to the following procedure. First, high-resolution digital images of live primary CGNs expressing YFP-STIM1 and incubated for 60 min in equiosmotic 65, 25, or 5 mM KCl imaging solution were collected using a 63× oil objective. Second, the length of visible neurites for each capture was measured and recorded. Third, background signal was removed by image segmentation using the clustering-based thresholding tool in ImageJ (NIH). The same background/foreground cutoff threshold was used for images of all three KCl conditions. Finally, distinct foreground objects greater than four pixels along neurites and cell bodies were manually counted as puncta and presented as the average number of YFP-STIM1 puncta per 20 μm of neurite length or per cell body for each experimental condition.

Immunocytochemistry

We used FLAG-Sp4 and a specific FLAG antibody to detect FLAG-Sp4 for quantitative immunocytochemical studies because in some Western blots with antisera recognizing Sp4, we noticed the presence of a minor nonspecific band. Although this did not influence our Western blot analyses and results, we considered this not optimal for quantitative immunocytochemical studies. Indirect immunofluorescence detection of antigens was carried out using CGNs cultured on poly-d-lysine–coated coverslips in 12-well plates. After experimental treatment, CGNs cells were washed twice with phosphate-buffered saline (PBS) and fixed for 30 min at room temperature with 4% paraformaldehyde in PBS. After fixation, cells were washed twice with PBS, permeabilized with PBST (PBS and 0.25% Triton X-100) for 20 min, blocked in blocking solution (5% goat nonimmune serum in PBS) for another 30 min, and finally incubated overnight at 4°C with the first primary antibody in blocking solution. The next day, coverslips were extensively washed with PBS and incubated for 2 hours at room temperature in the appropriate fluorophore-conjugated secondary antibody solution [Alexa 488– or Alexa 594–conjugated secondary antibody (Molecular Probes, Invitrogen) in blocking solution]. After washes with PBS, the coverslips were incubated again overnight in primary antibody solution for the second antigen, and the procedure for conjugation of the fluorophore-conjugated secondary antibody was repeated as above. Finally, cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole, and coverslips were mounted on glass slides with ProLong Antifade reagent (Invitrogen, Molecular Probes).

CGNs cultured on coverslips were imaged with a Spot RT2 color digital camera mounted on a Nikon E800 microscope. Image preparation, assembly, and analysis were performed with ImageJ and Photoshop CS. Change in contrast and evenness of the illumination was applied equally to all images presented in the study. The following procedure was used for pixel intensity measurements. First, original raw tiff files of transfected CGNs were opened in Photoshop CS, and pixel intensity corresponding to nuclear FLAG-Sp4 immunofluorescence was measured from 30-pixel spots. Second, for each measure of nuclear immunofluorescence pixel intensity, a measure of background pixel intensity from the same image channel was acquired and subsequently subtracted from the nuclear immunofluorescence pixel intensity value. Finally, mean pixel intensity of FLAG-Sp4 was calculated by averaging values from three independent biological replicates.

Statistics

All graphical representations are presented as means ± SEM unless specified otherwise. The statistical methods are described in the figure legends.

SUPPLEMENTARY MATERIALS

www.sciencesignaling.org/cgi/content/full/7/328/ra51/DC1

Fig. S1. Simultaneous inhibition of glutamatergic channels and VDCCs does not affect Sp4 abundance.

Fig. S2. 2-APB prevents hyperpolarization-induced degradation of Sp4.

Fig. S3. OAG does not promote Sp4 proteasomal degradation.

Fig. S4. Lowering the membrane potential triggers rapid disassembly of YFP-STIM1 puncta.

Fig. S5. STIM2 distribution in CGNs is not changed by [K+]ext.

Fig. S6. Colocalization of YFP-STIM1 and Orai2-His in CGNs.

Fig. S7. Sp1 abundance in primary CGNs is not influenced by STIM1-dependent SOCE.

Fig. S8. Model of SOCE-dependent regulation of Sp4 abundance in dissociated CGNs.

Movie S1. Imaging of a Ca2+ influx consistent with SOCE in resting CGNs.

Movie S2. The Ca2+ influx observed under resting conditions is blocked by SKF.

REFERENCES AND NOTES

Acknowledgments: We thank D. E. Clapham and N. Blair (Boston Children’s Hospital) as well as A. Lovy (Tufts University) and the Tufts Imaging Facility for providing assistance with Ca2+ imaging experiments. Funding: This work was supported in part by a grant from the NIH to G.G. (HD043364). J.L. was supported by a Postdoctoral Fellowship from the Canadian Institutes of Health Research, and G.S. was supported by the Synapse Neurobiology Training Program grant T32 NS061764 from the National Institute of Neurological Disorders and Stroke. The Tufts Imaging Facility is supported by grant P30 NS047243. Author contributions: The experiments were designed by J.L. and G.G. and performed by J.L. and G.S. All authors analyzed the data. The manuscript was prepared by J.L. with help from G.S. and G.G. Competing interests: The authors declare that they have no competing interests.
View Abstract

Stay Connected to Science Signaling

Navigate This Article