Research ArticleVASCULAR BIOLOGY

Loss of Reelin protects against atherosclerosis by reducing leukocyte–endothelial cell adhesion and lesion macrophage accumulation

See allHide authors and affiliations

Science Signaling  15 Mar 2016:
Vol. 9, Issue 419, pp. ra29
DOI: 10.1126/scisignal.aad5578

Reelin in leukocytes for atherosclerosis

The secreted protein Reelin has important functions in the central nervous system and in the vascular system. Receptors for Reelin are found on the endothelial cells that line blood vessels, prompting Ding et al. to investigate if Reelin contributed to atherosclerosis. Mice globally deficient in Reelin or lacking Reelin produced by the liver were protected from diet-induced atherosclerosis. Reelin deficiency prevented leukocytes from adhering to endothelial cells, a critical first step in the inflammatory response that promotes atherosclerosis. Blocking this activity of Reelin on endothelial cells may prevent atherosclerosis or complement existing strategies.

Abstract

The multimodular glycoprotein Reelin controls neuronal migration and synaptic transmission by binding to apolipoprotein E receptor 2 (Apoer2) and very low density lipoprotein receptor (Vldlr) on neurons. In the periphery, Reelin is produced by the liver, circulates in blood, and promotes thrombosis and hemostasis. To investigate if Reelin influences atherogenesis, we studied atherosclerosis-prone low-density lipoprotein receptor–deficient (Ldlr−/−) mice in which we inducibly deleted Reelin either ubiquitously or only in the liver, thus preventing the production of circulating Reelin. In both types of Reelin-deficient mice, atherosclerosis progression was markedly attenuated, and macrophage content and endothelial cell staining for vascular cell adhesion molecule–1 (VCAM-1) and intercellular adhesion molecule–1 (ICAM-1) were reduced at the sites of atherosclerotic lesions. Intravital microscopy revealed decreased leukocyte-endothelial adhesion in the Reelin-deficient mice. In cultured human endothelial cells, Reelin enhanced monocyte adhesion and increased ICAM1, VCAM1, and E-selectin expression by suppressing endothelial nitric oxide synthase (eNOS) activity and increasing nuclear factor κB (NF-κB) activity in an Apoer2-dependent manner. These findings suggest that circulating Reelin promotes atherosclerosis by increasing vascular inflammation, and that reducing or inhibiting circulating Reelin may present a novel approach for the prevention of cardiovascular disease.

INTRODUCTION

Reelin is an extracellular matrix glycoprotein that was originally found in the developing brain where it is secreted by Cajal-Retzius neurons in the marginal zone (1, 2). In neurons, Reelin binds to its cognate receptors apolipoprotein E receptor 2 (Apoer2) and the very low density lipoprotein receptor (Vldlr) on the cell surface (3), thereby promoting tyrosine phosphorylation of the cytoplasmic adaptor protein disabled homolog 1 (Dab1) (1, 4). Phosphorylated Dab1 then activates a series of signal transduction mechanisms that control various cellular functions, including neuronal positioning during brain development, synaptic plasticity, and memory formation (5). Reelin also regulates lymphatic vessel development (6), interacts with the Notch signaling pathway (7, 8), binds to ephrins (9, 10) and their ephrin ligands (9), and has further been reported to interact with integrins (1113). Experimental and clinical studies indicate that increased Reelin abundance is protective (1416), whereas reduced Reelin abundance in the brain is associated with several neurodegenerative disorders including Alzheimer’s disease (1720).

In addition to the central nervous system (CNS), Reelin is also present in the circulation, the liver, and some other tissues (21). In the liver, Reelin is produced by stellate cells, not hepatocytes (22). It promotes platelet spreading on fibrinogen and also plays a role in coagulation by enhancing thrombin generation and the formation of fibrin clots (23, 24). There is evidence that the two receptors for Reelin, Apoer2/Lrp8 and Vldlr, influence atherosclerosis severity. In macrophages, Apoer2 reduces stress-induced cell death and potentially retards the development of advanced atherosclerotic plaques (25). In contrast, macrophage Vldlr promotes atherosclerotic lesion development (26). Both Reelin receptors are also present in endothelial cells, where Apoer2 mediates the antiatherogenic actions of ApoE3 (27).

To investigate whether Reelin affects atherosclerosis propensity and whether this involves Reelin binding to its receptors in the periphery, we generated mice with inducible inactivation of Reelin either ubiquitously or selectively only in the circulation. To accelerate atherosclerotic lesion development, Reelin inactivation was performed in low-density lipoprotein receptor–deficient mice (Ldlr−/−), which are prone to hypercholesterolemia when fed a cholesterol-enriched diet (28). We also investigated how Reelin affected leukocyte adhesion to the endothelium and the accumulation of monocytes and macrophages in the vascular wall. Our findings revealed that circulating Reelin promoted the vascular inflammatory response and thus atherosclerosis by increasing leukocyte–endothelial cell adhesion, thereby facilitating the infiltration of inflammatory macrophages into the arterial wall through Apoer2 and the increased expression of mRNAs encoding endothelial adhesion molecules. We further showed that reduction of Reelin in the plasma was sufficient to protect the vascular wall from cholesterol-induced atherosclerosis. Therefore, reducing or inhibiting circulating Reelin, for instance, with neutralizing antibodies, small interfering RNA (siRNA), or recombinant decoy receptors, presents a conceptually novel strategy to prevent cardiovascular disease and potentially other disorders that are initiated or promoted by the excessive extravasation of leukocytes or monocytes.

RESULTS

Reelin is effectively depleted in conditional Reln−/−;Ldlr−/− mice

To explore the potential role of Reelin in the pathogenesis of atherosclerosis, Ldlr−/− mice were crossed with floxed Reln mice expressing a tamoxifen-inducible Cre recombinase under the control of the ubiquitously active CAG promoter. Cre-negative littermates were used as controls. Immunoblot analysis confirmed that tamoxifen injection induced the absence of Reelin protein in the plasma, brains, and livers of the double knockout (DKO) mice (fig. S1A). To segregate the potential effects of circulating Reelin on atherosclerosis from those of systemic Reelin, we additionally generated mice with selective deletion of Reelin only in plasma by injecting Relnfl/fl;Ldlr−/− mice through the tail vein with adenovirus expressing Cre recombinase (Ad-Cre) or β-galactosidase (Ad-Gal) as control. Immunoblot analysis demonstrated efficient and specific ablation of Reelin from the liver and plasma, but not from the brain in the Ad-Cre–injected Relnfl/fl;Ldlr−/− mice (fig. S2A).

Plasma lipid parameters were determined in all mice after feeding with a high-cholesterol diet for 16 weeks. DKO and Ldlr−/− mice had similar body weights, and plasma cholesterol or triglyceride concentrations (fig. S1B) and the atherogenic diet caused similarly severe hypercholesterolemia with comparable lipid profiles for cholesterol and triglyceride in the two groups of mice (fig. S1, C and D). In the adenovirus-treated groups, total plasma cholesterol was modestly increased in Ad-Gal Relnfl/fl;Ldlr−/− mice compared to Ad-Cre Relnfl/fl;Ldlr−/− mice, whereas plasma triglyceride and high-density lipoprotein cholesterol (HDL-C) concentrations were similar in the two groups (fig. S2B). Cholesterol feeding had no effect on plasma Reelin concentrations in animals that were wild type for Reelin (fig. S3).

Reelin deficiency reduces atherosclerosis in Ldlr−/− mice

After high-cholesterol feeding for 16 weeks beginning at 8 weeks of age, aortas were excised and stained with Oil Red O to visualize atherosclerotic plaques. En face analyses revealed a 52% decrease in atherosclerotic lesion area in aortas from DKO mice with global Reelin deletion compared to the aortas of Ldlr−/− control mice (Fig. 1A). Quantitative analysis of lesion areas in cross sections of the aortic sinus showed a similar 47% reduction in lesion size in DKO mice compared to controls (Fig. 1B). Similarly, Ad-Cre Relnfl/fl;Ldlr−/− mice displayed a 46% decrease of atherosclerotic lesion area in the aorta and a 73% reduction of aortic root lesions compared with Ad-Gal Relnfl/fl;Ldlr−/− mice (Fig. 1, C and D). Thus, both global and plasma-selective Reelin deficiency greatly diminished atherosclerotic lesion formation.

Fig. 1 Reelin deficiency attenuates atherosclerotic lesion development in Ldlr−/− mice.

(A) Representative en face photomicrographs (left) and average percent of aortic lesion area in male Ldlr−/− (n = 11) and DKO (n = 16) mice (right; ****P < 0.0001). (B) Representative photomicrographs of aortic root sections stained with Oil Red O (left) and quantification of atheroma area in Ldlr−/− (n = 6) and DKO (n = 9) mice (right; ***P = 0.0005). (C) Representative en face photomicrographs (left) and average percent of aortic lesion area in Ad-Gal Relnfl/fl;Ldlr−/− (n = 15) and Ad-Cre Relnfl/fl;Ldlr−/− (n = 8) mice (right; **P = 0.0029). (D) Representative photomicrographs of aortic root sections stained with Oil Red O (left) and quantification of the atheroma area in Ad-Gal Relnfl/fl;Ldlr−/− (n = 6) and Ad-Cre Relnfl/fl;Ldlr−/− (n = 5) mice (right; **P = 0.0053). Summary plots depict means ± SEM. Additional statistical details are summarized in table S1.

Reelin deficiency reduces adhesion molecule abundance and macrophage infiltration

We next investigated the presence of macrophages and smooth muscle cells in atherosclerotic plaques from DKO and Ldlr−/− control mice by immunostaining with antibodies directed against Mac-3 and α-actin, respectively. Morphometric quantification of the lesions revealed a 32% reduction of Mac-3–positive macrophages in DKO compared to Ldlr−/− control mice (Fig. 2A). No difference in α-actin–positive (smooth muscle) area was observed between the two groups.

Fig. 2 Global Reelin deficiency decreases monocyte recruitment to atherosclerotic lesions in Ldlr−/− mice.

(A) Representative aortic root cross sections from Ldlr−/− and DKO mice stained with specific antibodies for markers of macrophages (Mac-3 protein, green) and smooth muscle cells (α-actin protein, red) (left) and the average positive staining (right, normalized to lesion area) for Mac-3 (*P = 0.0349) and α-actin (P = 0.7612). (B) Representative aortic sinus sections from Ldlr−/− and DKO mice stained with specific antibodies for VCAM-1 (green) and ICAM-1 (red) (left) and the average positive staining (right; normalized to endothelium area, as indicated by white dotted line) for VCAM-1 (*P = 0.0301) and ICAM-1 (***P = 0.0012). In (A) and (B), sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (blue) to stain nuclei. White arrows indicate positive staining, and summary plots represent means ± SEM (n = 6 to 7 animals per genotype; average of three to six sections per animal). Additional statistical details are summarized in table S1.

The migration of monocytes into the subendothelium of arteries in atherosclerosis results from the cytokine-mediated activation of endothelial cells, which leads to increases in the abundance of leukocyte adhesion molecules. To determine the basis for the impact of Reelin on lesion macrophage accumulation, we measured vascular cell adhesion molecule–1 (VCAM-1) and intercellular adhesion molecule–1 (ICAM-1) abundance in plaques by immunostaining with antibodies directed against CD106 and CD54, respectively. VCAM-1 was reduced by 65% and ICAM-1 by 56% in endothelium overlying plaques in DKO mice compared to Ldlr−/− mice (Fig. 2B). Mac-3, CD106, and CD54 immunoreactivity was similarly reduced in the lesions of Ad-Cre Relnfl/fl;Ldlr−/− compared to Ad-Gal Relnfl/fl;Ldlr−/− mice (fig. S4). These results suggest that Reelin promotes macrophage foam cell accumulation in atherosclerotic lesions, and that this is likely driven by increased adhesion molecule expression.

Reelin increases leukocyte–endothelial cell adhesion

Leukocyte recruitment to sites of perivascular inflammation, including atherosclerotic lesions, is a key event in the initiation and progression of vascular injury and repair and is enhanced by hypercholesterolemia (29). To better understand the mechanisms by which Reelin promotes macrophage accumulation in atherosclerosis, intravital microscopy was performed to quantify leukocyte-endothelial adhesion in vivo in the absence and presence of Reelin. Male DKO and Ldlr−/− mice were intraperitoneally injected for 5 days with tamoxifen, and the tamoxifen-induced reduction of circulating Reelin was confirmed by Western blotting. Endogenous leukocytes, consisting predominantly of lymphocytes and neutrophils, were fluorescently labeled by injection of rhodamine 6G, and intravital video microscopy was performed to visualize leukocyte adhesion to the endothelium in the mesenteric microvasculature. Leukocyte velocity was increased by 25%, and the number of adherent leukocytes was reduced by 78% in DKO mice compared with Ldlr−/− mice (Fig. 3, A and B, and movies S1 and S2). Total circulating white blood cell (WBC) and leukocyte subsets were similar between DKO and Ldlr−/− mice (Fig. 3C), suggesting that Reelin increases leukocyte–endothelial cell adhesion in vivo.

Fig. 3 Global Reelin deficiency reduces leukocyte–endothelial cell adhesion without affecting circulating WBC number.

(A) Representative images of leukocyte–endothelial cell adhesion in the mesenteric microcirculation in male Ldlr−/− and DKO mice after daily intraperitoneal injection of tamoxifen for 5 days. (B) Summary plots depicting the average leukocyte velocity (left; *P = 0.0136) and the number of adherent leukocytes (right; ***P = 0.0003) in Ldlr−/− and DKO mice (n = 10 animals per genotype). (C) Summary graphs depicting the average total WBC count (P = 0.5524) and average number of leukocyte subtypes in plasma from Ldlr−/− (n = 6) and DKO (n = 7) mice (not significant). MO, monocyte; LY, lymphocyte; NE, neutrophils; EO, eosinophil; BA, basophil. Summary plots depict means ± SEM. Additional statistical details are summarized in table S1.

To determine whether direct actions of Reelin on endothelial cells underlie the apparent increase in adhesion and whether these processes operated in human endothelium, we used U937 cells to investigate monocyte adhesion to cultured primary human aortic endothelial cells (HAECs). Compared with vehicle- or mock-treated HAECs, Reelin caused a greater than twofold increase in adhesion (Fig. 4, A and B), which was completely prevented by the Reelin function-blocking antibody CR50 (Fig. 4C) (30, 31). siRNA knockdown of Vldlr or Apoer2 mRNAs was performed to identify the Reelin receptor that mediates the increase in endothelial cell–monocyte adhesion. Although loss of Vldlr did not alter the effect of Reelin (Fig. 4D), Apoer2 knockdown completely prevented the Reelin-mediated increase of endothelial cell–monocyte adhesion (Fig. 4D and fig. S5). These results indicate that Reelin enhances adhesion through its action on Apoer2 and not Vldlr in endothelium.

Fig. 4 Reelin enhances monocyte–endothelial cell adhesion and blunts VEGF-induced eNOS activation through Apoer2.

(A) Representative images of U937 monocytes (small, round cells) adhered to HAECs (cobblestone shape) treated with vehicle, mock, or Reelin. Scale bar, 200 μm. (B to F) Summary plots depicting means ± SEM of the following: (B) number of adherent monocytes per 40× field of view in (A) (n = 6 independent experiments; ****P < 0.0001). (C) Monocyte-HAEC adhesion with mock, Reelin ± mouse immunoglobulin G (IgG), or CR50 (n = 6 independent experiments; ***P < 0.002, ****P < 0.0001). (D) Monocyte-HAEC adhesion with vehicle, mock, or Reelin (top) after transfection with either control [control RNA interference (RNAi)], double-stranded RNA targeting Apoer2 (left; n = 3 independent experiments; ****P < 0.0001), or Vldlr (right; n = 3 independent experiments; ****P < 0.0009). In parallel, whole-cell lysates were immunoblotted for Vldlr or Apoer2 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (bottom). (E) VEGF-stimulated eNOS activity in HAECs with or without Apoer2 knockdown, pretreated with or without mock or Reelin (n = 6 independent experiments; *P < 0.02, **P < 0.006, ****P < 0.0001). (F) Monocyte-HAEC adhesion in the presence of mock or Reelin ± SNAP (n = 6 independent experiments; **P = 0.0081, ***P = 0.0001). Additional statistical details are summarized in table S1.

Reelin antagonizes endothelial NOS through Apoer2

Nitric oxide (NO) generated by endothelial NO synthase (eNOS) is a key modulator of leukocyte–endothelial cell adhesion (32). Having previously shown that Apoer2 mediates antiphospholipid antibody–induced suppression of eNOS, which increases endothelial cell–leukocyte adhesion (33), we next determined whether Reelin alters eNOS activity in HAECs through Apoer2. eNOS activation by vascular endothelial growth factor (VEGF) was quantified by measuring [14C]arginine conversion to [14C]citrulline in intact HAECs. Although VEGF increased eNOS activity in nontreated and mock-treated cells, Reelin attenuated eNOS activation (Fig. 4E). siRNA knockdown of Apoer2 fully prevented Reelin-mediated inhibition of eNOS activation. The NO donor S-nitroso-N-acetylpenicillamine (SNAP) also completely prevented the Reelin-mediated increase in leukocyte adhesion (Fig. 4F). Together, these data show that Reelin signaling to Apoer2 increases leukocyte adhesion at least in part through reduction of eNOS activity.

Reelin increases the expression of mRNAs encoding endothelial adhesion proteins

To determine whether Reelin promotes endothelial cell–leukocyte/monocyte adhesion through increased expression of the major endothelial adhesion molecules VCAM-1, ICAM-1, and E-selectin as occurs during atherogenesis (34, 35), we performed quantitative reverse transcription polymerase chain reaction (RT-PCR) of mock- and Reelin-treated HAECs. The expression of mRNAs for all three adhesion proteins, which are transcriptionally enhanced during inflammatory conditions, was significantly increased by Reelin treatment, and these increases were prevented by the Reelin function-blocking CR50 antibody (Fig. 5A). By contrast, P-selectin mRNA expression was not regulated by Reelin under the conditions tested (Fig. 5A, rightmost panel). The Reelin-induced increase in VCAM1, ICAM1, and E-selectin expression was prevented by siRNA knockdown of Apoer2 (Fig. 5B) and by SNAP treatment (Fig. 5C), suggesting again an NO-sensitive mechanism.

Fig. 5 Reelin activates the expression of mRNAs for endothelial adhesion molecules in HAECs.

(A) Summary plots depicting the relative (Rel.) transcript abundance of VCAM1 (**P < 0.01), ICAM1 relative to HPRT1 (***P < 0.0005), E-selectin (***P = 0.0014, ***P = 0.0005), and P-selectin relative to 36B4 (not significant) in HAECs treated with mock or Reelin ± CR50 evaluated by RT-PCR (n = 3 or more independent experiments). (B) Quantitative PCR (qPCR) for the expression of VCAM1 (n = 6 independent experiments; **P = 0.002, ***P = 0.0005), ICAM1 (***P < 0.002), and E-selectin (**P = 0.0088, ***P = 0.0007) in HAECs treated with mock or Reelin after transfection with either control (control RNAi) or double-stranded RNA targeting Apoer2 (left and middle, n = 6 independent experiments; right, n = 3 independent experiments). (C to E) qPCR for the expression of VCAM1 (C) (no SNAP, **P = 0.0043; SNAP, P = 0.9964), ICAM1 (D) (no SNAP, ****P < 0.0001; SNAP, P = 0.0579), and E-selectin (E) [no SNAP, **P = 0.0021; SNAP (right), P = 0.0861] in HAECs treated with mock or Reelin ± SNAP (n = 6 independent experiments). Summary plots depict means ± SEM. Additional statistical details are summarized in table S1.

Reelin increases adhesion molecule expression through NF-κB

The transcription factor nuclear factor κB (NF-κB) is the major driver of VCAM1, ICAM1, and E-selectin expression (36). Moreover, NO can directly inhibit NF-κB through S-nitrosylation of its subunits (37), suggesting that the Reelin-mediated increased adhesion molecule gene expression is NF-κB–dependent. Exposure of HAECs to Reelin triggered the rapid phosphorylation and thus inactivation of the endogenous NF-κB inhibitor IκBα (Fig. 6A). Conversely, parthenolide, an inhibitor of IκB kinase (38), completely prevented the Reelin-dependent induction of VCAM1, ICAM1, and E-selectin (Fig. 6, B to D), confirming that Reelin increases the expression of the mRNAs for these adhesion molecules through activation of the NF-κB signaling pathway.

Fig. 6 Reelin induces IκBα phosphorylation and activates NF-κB in HAECs.

(A) Representative Western blot shows the effect of Reelin on the phosphorylation (p) of IκBα (the upper and lower bands represent phospho-IκBα and non–phospho-IκBα, respectively) in HAECs (n = 2 independent experiments). Incubations were terminated at the indicated time points after addition of purified Reelin or medium. (B to D) qPCR for the expression of VCAM1 (B) (****P < 0.0001), ICAM1 (C) (***P = 0.0003, ****P < 0.0001), and E-selectin (D) (****P < 0.0001) in HAECs treated with mock or Reelin with or without parthenolide (n = 3 to 16 replicates per treatment over three independent experiments). Summary plots depict means ± SEM. Additional statistical details are summarized in table S1.

Together, the data we have presented support a model (Fig. 7) in which Reelin regulates the expression of major vascular adhesion molecules. This establishes a “primed” state for mounting a rapid reaction to pathological conditions in the vascular wall and the perivascular space that trigger an innate immunity response, such as oxidized LDL or lipopolysaccharides (39).

Fig. 7 Model of Reelin actions on the vascular endothelium.

(A and B) In the presence of circulating Reelin, endothelial Apoer2 attenuates eNOS and induces the phosphorylation of IκBα, which prevents IκBα from inhibiting NF-κB, a transcription factor that (B) increases the expression of mRNAs for the vascular adhesion molecules VCAM-1, ICAM-1, and E-selectin. (C) This results in the prolonged attachment of circulating leukocytes and monocytes and improves their surveillance of vascular and perivascular health by increasing their receptiveness to chemotactic or inflammatory stimuli emanating from the subendothelial space (such as oxidized LDL, symbolized by the yellow stars), thereby indirectly increasing the likelihood of initiating diapedesis. (D) In the absence of Reelin, Apoer2 is unoccupied, eNOS is not attenuated, and IκBα is not phosphorylated and thus able to inhibit NF-κB. (E) Consequently, the relative expression of the NF-κB–responsive adhesion molecules is reduced (symbolized by their light gray color) and attachment of circulating leukocytes/monocytes is diminished. (F) The reduced opportunity to interact with adhesion molecules diminishes the likelihood of a passing leukocyte or monocyte to productively engage the vascular wall and initiate diapedesis in response to chemotactic signals, resulting in reduced macrophage accumulation and atherosclerosis.

DISCUSSION

Reelin, a regulator of brain development and synaptic neuromodulator that signals through ApoE receptors, is also abundant in the liver and present at substantial concentrations in the circulation (21, 23, 24). Here, we used two distinct types of Reelin conditional knockout mice to determine how Reelin affected atherosclerosis. Consistent with earlier studies, our results indicated that the circulating pool of Reelin was peripherally derived, primarily from the liver, and that it did not originate from the CNS (21). Using these genetic loss-of-function strategies, we found that Reelin potently promoted leukocyte-endothelial adhesion and atherosclerosis in mice.

Arteriosclerosis, thrombosis, and inflammatory tissue reactions in general share common vascular response mechanisms that include the recruitment of leukocytes and monocytes to the site of injury, followed by their transmigration into the vascular wall and perivascular space. Although atherosclerosis specifically affects arterial vessels, as opposed to the venous system, and is marked by the subendothelial accumulation of lipids and lipid-laden foam cells (40), it shares the recruitment of circulating leukocytes and monocytes to the developing and progressing lesions with other inflammatory processes that involve the vasculature. Reelin has been reported to affect thrombosis and hemostasis (23, 24). Here, we have shown that Reelin promotes atherosclerosis by increasing leukocyte adhesion to the vascular endothelium through increased abundance of the major adhesion molecules that are induced during atherogenesis and that promote the accumulation of macrophages in the lesions—ICAM-1, VCAM-1, and E-selectin (34, 35, 41, 42).

Previous studies of the Reelin receptors Apoer2 and Vldlr in the context of atherosclerosis have investigated cell-autonomous mechanisms of these receptors in macrophages (25, 26). Functional analysis of macrophage Apoer2 in Ldlr−/− mice suggests that deficiency of the receptor enhances macrophage susceptibility to lipid accumulation and cell death to augment atherosclerotic plaque progression in vivo (25). In contrast, the transplantation of Vldlr-positive macrophages into Vldlr−/− mice markedly accelerates the development of atherosclerotic lesions, suggesting a proatherogenic role of macrophage Vldlr (26). Analysis of cultured macrophages has suggested that the activation of Vldlr and Apoer2 by Reelin or ApoE3 might increase ABCA1 abundance to promote macrophage cholesterol efflux, thus providing evidence for a potential antiatherogenic role for Reelin (43). Furthermore, the treatment of Vldlr- and Apoer2-overexpressing macrophages with ApoE converts these cells from the proinflammatory M1 to the anti-inflammatory M2 phenotype (44), potentially indicating anti-inflammatory actions of the receptors. In contrast to these previous studies, we focused on the ligand for these receptors, and the discrete manipulation of Reelin in mice addressed how this neurodevelopmentally essential ligand, which is also abundantly produced by stellate cells in the liver, promotes atherosclerosis in vivo by aggravating vascular inflammation through enhanced macrophage/monocyte adhesion and thus facilitating their subsequent transmigration in response to other chemotactic signals into the vascular wall (Fig. 7).

During atherosclerotic lesion development, endothelial dysfunction is an early event that precedes clinical manifestations and complications (45, 46). After activation by proinflammatory cytokines, oxidized lipids, or other mediators of the innate immunity response (39), endothelial cells of the vascular wall produce chemokines and adhesion molecules, provoking leukocyte–endothelial cell adhesion and, in turn, recruiting inflammatory cells into the lesions (47). Vldlr deficiency or endothelial overexpression of Vldlr does not affect atherosclerotic lesion development in Ldlr knockout mice, suggesting a modest role at best for Vldlr in endothelial cells in atherogenesis (48). By contrast, we have previously reported that Apoer2 in endothelial cells reduces NO synthesis and promotes leukocyte–endothelial cell adhesion when Apoer2 is mediating the actions of antiphospholipid antibodies, but enhances NO signaling when ApoE3 is the ligand (33, 49). Here, we showed that hypercholesterolemic Ldlr−/− mice lacking Reelin either systemically or only in their circulation display decreased staining for vascular adhesion markers (Fig. 2), resulting in attenuated leukocyte–endothelial cell adhesion (Fig. 3) and reduced atherosclerotic plaque size (Fig. 1). We noticed two important differences in the studies in which we used recombinant adenoviruses to selectively delete Reelin in the circulation. First, the total lesion area was greater in the mice that received recombinant adenovirus, either the Ad-Gal control virus or the Ad-Cre virus (Fig. 1C), than in the mice in which Cre-mediated recombination was induced with tamoxifen (Fig. 1A). Second, total plasma cholesterol concentrations were somewhat higher in the mice that had received Ad-Gal (fig. S2B), whereas they were similar in the mice that had received Ad-Cre (fig. S2B) or tamoxifen (fig. S1B). These differences likely reflect the contribution of adenovirus-induced inflammation to the results and highlight a possible common complication of using virus-mediated gene transfer or other invasive manipulations (like bone marrow transplantation) in atherosclerosis experiments. Nevertheless, the results of the adenovirus experiments are consistent with the results obtained in the tamoxifen-treated groups, thereby further supporting the role of Reelin in atherogenesis.

Studies in primary human endothelial cells suggested that the effect of Reelin on the abundance of the major adhesion molecules that mediate leukocyte/monocyte adhesion to the vascular endothelium (Fig. 5) underlies its proinflammatory actions, and that these likely involve Reelin inhibition of eNOS through Apoer2 (Fig. 4) and Reelin-mediated activation of NF-κB (Fig. 6). Collectively, these observations indicate that the impact of Reelin on atherosclerosis is at least partially caused by its actions on the endothelium.

Our findings are of considerable translational importance, because they suggest a conceptually novel strategy to prevent atherosclerosis and cardiovascular disease. The most effective antiatherosclerosis therapies to date all target the accumulation of cholesterol in the lesions, by reducing plasma cholesterol either with statins or with antibodies against the LDL receptor antagonist PCSK9 (50, 51). The U.S. Food and Drug Administration (FDA)–approved anti-PCSK9 strategies in particular demonstrate the power and ease of systemic antibody application to remove the physiological antagonist (PCSK9) of a beneficial agonist (LDL receptor). In analogy, neutralizing antibodies against Reelin should be similarly beneficial, functioning synergistically by attacking another atherosclerosis-promoting mechanism, the endothelial adhesion of blood monocytes. Conceivable alternative strategies involve siRNA- or antisense oligonucleotide–directed ablation of peripheral Reelin production or systemic application of recombinant function-blocking decoy receptors, a strategy that is successfully used for anti-TNF (tumor necrosis factor) therapy (52). In addition, removing or inhibiting circulating Reelin could be expected to further protect against thrombosis by reducing platelet adhesion (23) and clotting propensity (24), factors that also promote atherogenesis. Likewise, suppression of circulating Reelin might also be beneficial in other diseases in which excessive leukocyte/monocyte extravasation contributes to the pathology.

In summary, the conditional Reelin knockout mouse has provided us with a model to study the impact of Reelin on atherosclerosis and the underlying cellular processes. Our cumulative results show that circulating Reelin promotes atherosclerosis development, which is likely attributable to various synergistic molecular mechanisms. These include (i) the Reelin-induced reduction of eNOS and simultaneous increase of NF-κB activity via Apoer2, resulting in (ii) increased leukocyte-endothelial adhesion and (iii) monocyte/macrophage accumulation in expanding atherosclerotic lesions. These cellular mechanisms, combined with a direct prothrombotic function of Reelin (24), represent peripheral proatherogenic effects of this essential regulator of brain development, synaptic plasticity, learning, and memory. Reelin and its surprising modes of action in the context of atherosclerosis open up new avenues to pursue in our efforts to combat cardiovascular disease and potentially other disorders that are driven by excessive leukocyte extravasation.

MATERIALS AND METHODS

Animal models

Mice carrying the loxP-targeted Reln gene (which encodes the protein Reelin) were generated by gene targeting murine SV129J embryonic stem cells as described previously (15) and mated with Ldlr−/− (28) mice to yield double homozygotes (Relnfl/fl;Ldlr−/−). Relnfl/fl;Ldlr−/− mice were then crossbred with CAG-Cre mice (The Jackson Laboratory, strain 004682) to obtain CAG-Cre+ Relnfl/fl;Ldlr−/− mice and their Cre-negative littermates. To induce Cre-mediated DNA recombination, 6-week-old Relnfl/fl;Ldlr−/− mice with or without the CAG-Cre transgene were intraperitoneally injected with tamoxifen (0.135 mg/g) dissolved in sunflower oil for five consecutive days to yield global Reln and Ldlr DKO mice and Ldlr−/− (control) mice. To elucidate the role of circulating Reelin in atherogenesis, 6-week-old Relnfl/fl;Ldlr−/− mice were intravenously injected either with adenovirus vector encoding Cre recombinase (Ad-Cre) to generate mice lacking circulating Reelin (Ad-Cre Relnfl/fl;Ldlr−/−) or with adenovirus vector encoding β-galactosidase (Ad-Gal) to generate control mice (Ad-Gal Relnfl/fl;Ldlr−/−). The Ad-Cre and Ad-Gal viruses were produced as described previously (53). Two weeks after injection with either tamoxifen or adenovirus, Reelin concentrations in the plasma, brain, and liver were determined by Western blotting. To evaluate atherosclerosis severity, 8-week-old male mice of each genotype, either lacking or expressing Reelin, were placed on an atherogenic high-cholesterol diet containing 21% (w/w) milk fat, 1.25% (w/w) cholesterol, and 0.5% (w/w) cholic acid (TD 02028, Harlan Laboratories). In select experiments, WBC counts and differentials were performed by collecting fresh blood obtained through retro-orbital bleeding in EDTA-containing tubes. A ProCyte Dx Hematology Analyzer (IDEXX Laboratories) was used to quantify the five major WBC subpopulations: neutrophils, lymphocytes, monocytes, eosinophils, and basophils. All animal procedures were performed according to protocols approved by the Institutional Animal Care and Use Committee at the University of Texas Southwestern Medical Center at Dallas.

Cell culture and transfection

HAECs (Cambrex Corp.) were cultured in EBM2 (endothelial basal medium 2) (Lonza) containing 10% fetal bovine serum (FBS) and used within three to six passages. The monocyte cell line U937 (human histiocytic lymphoma, American Type Culture Collection) was grown in RPMI 1640 medium (Sigma-Aldrich) containing 10% FBS. In siRNA experiments, HAECs were transfected using siPORT amine transfection reagent (Life Technologies). Double-stranded siRNA directed against Vldlr (s14811) with the functional sequence GCAGUGUAAUGGUAUCCGAtt or Apoer2 (s15365) with the functional sequence CAUCCCUAAUCUUCACCAAtt was purchased from Life Technologies. Alternative double-stranded siRNA directed against Apoer2 with the functional sequence CCUUGAAGAUGAUCCACUAUU and control siRNA (D0018100250) were from GE Healthcare Dharmacon Inc. The siRNA-mediated silencing of Apoer2 or Vldlr was evaluated by immunoblot analysis.

Immunoblot analysis

Protein samples from plasma, tissues, or HAEC whole-cell lysates were prepared in radioimmunoprecipitation assay buffer and separated by SDS–polyacrylamide gel electrophoresis. After transfer onto nitrocellulose membranes (Bio-Rad), blots were probed separately with antibodies against mouse Reelin (G10), mouse Apoer2, and Vldlr as indicated. The G10 antibody was a gift from A. Goffinet (Université catholique de Louvain, Belgium) (54). The function-blocking CR50 antibody was provided by K. Mikoshiba (RIKEN, Saitama, Japan). The Vldlr antibody was purchased from Millipore Corporation (catalog no. MABS25), and the Apoer2 antibody was generated in our laboratory as described previously (55). Antibodies against IκBα (catalog no. 4812) and β-actin (catalog no. 8457) were purchased from Cell Signaling Technology. Antibody against phospho-Ser32/Ser36-IκBα (catalog no. ab12135) was purchased from Abcam. The secondary antibody used was horseradish peroxidase–linked anti-mouse IgG or anti-rabbit IgG (GE Healthcare), and membranes were visualized with SuperSignal West Pico chemiluminescence reagents and x-ray film. Band intensity was quantified using scanning densitometry of nonsaturating autoradiograms with ImageJ software [National Institutes of Health (NIH)] within linear exposure range.

Plasma lipids and lipoprotein profiles

At termination, blood was collected from mice by tail bleeding after an overnight fasting period, and plasma was separated by centrifugation. Plasma lipids (total cholesterol and triglyceride) were determined using kits from Thermo Scientific. HDL-C was quantified after precipitation of ApoB-containing lipoproteins with an equal volume of a 20% polyethylene glycol solution as previously described (56). Lipoprotein profiles were determined by fractionation of pooled 500 μl of plasma from five mice in each group using a Superose 6 column (Amersham Pharmacia).

Atherosclerotic lesion analysis

Mice fed a high-cholesterol diet for 16 weeks were euthanized by anesthetic overdose. Hearts were perfused with phosphate-buffered saline (PBS) and 4% paraformaldehyde, and hearts and the entire aorta were collected. For en face analysis, entire aortas from the heart extending 5 to 10 mm beyond the bifurcation of the iliac arteries were removed and dissected free of adjoining tissues, opened, and stained with Oil Red O. Lesion extent was evaluated by morphometry of scanned images using ImageJ software. For the analysis of lesions in the aortic sinus, 10-μm-thick serial cryosections were taken from the region of the proximal aorta through the aortic sinuses and stained with Oil Red O or hematoxylin. Quantitative immunostaining was performed using primary antibodies against Mac-3 (1:200; BD Pharmingen), α–smooth muscle actin (1:200; Abcam), CD106 (1:40; BD Pharmingen), or CD54 (1:40; R&D Systems) and fluorescently labeled secondary antibodies goat anti-rat Alexa Fluor 488 (Thermo Fisher Scientific, A11006), donkey anti-goat Alexa Fluor 594 (Thermo Fisher Scientific, A11058), or goat anti-rabbit Alexa Fluor 594 (Thermo Fisher Scientific, A11012). Nuclei were counterstained with DAPI (Thermo Fisher Scientific, P36935). Images were obtained with a Zeiss Axiophot microscope, and the percentage of lesion area that was positively stained was determined using Image-Pro v.6.2 (Media Cybernetics).

Intravital microscopy for quantification of leukocyte–endothelial cell adhesion

Leukocyte–endothelial cell adhesion was evaluated as described previously (57). Briefly, 3-week-old male mice were intraperitoneally injected with vehicle or tamoxifen daily for 5 days. After tamoxifen-mediated knockdown of circulating Reelin was confirmed by immunoblotting, the mice were prepared for intravital microscopy. Endogenous leukocytes were fluorescently labeled by injection with rhodamine 6G (100 μl of 0.05% solution given via optic vascular plexus), and the mesentery was exposed for the observation and recording of images of leukocyte adhesion and rolling using a Regita digital camera (QImaging). The velocity and quantity of leukocyte rolling were measured by Image-Pro v.6.2 (Media Cybernetics). In preliminary studies, the effects of tamoxifen on adhesion were evaluated in Relnfl/fl;Ldlr−/− mice treated daily for 5 days with tamoxifen or vehicle. WBC velocity was similar in tamoxifen- and vehicle-treated mice (movies S3 and S4).

Monocyte adhesion assay

The adhesion of U937 monocytes to monolayers of HAEC was evaluated as previously described (33). Recombinant Reelin and mock-conditioned medium were collected and purified by column chromatography and size exclusion filtration from the supernatant of stably transfected 293 cells and nontransfected 293 cells, respectively (58). Confluent HAECs were treated with vehicle, mock medium (20 μl/1 ml), Reelin (20 nM), or Reelin (20 nM) and CR50 (100 nM) for 16 hours. Subsequently, HAECs were washed with PBS and rinsed with RPMI 1640 medium, U937 monocytes (1 × 106 cells per well) were added and incubated with HAEC under rotating conditions (benchtop incubator at 70 rpm) at 37°C for 20 min, nonadherent monocytes were removed by gentle washing with PBS, cells were fixed with 1% paraformaldehyde for 10 min at room temperature, and the number of adherent cells was determined in triplicate per ×40 magnification field by ImageJ software. In select studies, HAECs were transfected with control, Apoer2, or Vldlr siRNA or treated with 20 μM NO donor SNAP (Santa Cruz Biotechnology, sc-200319) or with 3 or 10 μM parthenolide (EMD Millipore, catalog no. 512732) before the treatment with mock medium or Reelin.

eNOS activation assay

eNOS activation was determined in intact endothelial cells by measuring the conversion of [14C]l-arginine to [14C]l-citrulline as previously described (33). Briefly, HAECs were pretreated with vehicle, mock medium, or Reelin for 30 min and eNOS activity was then assessed over 15 min in the continued presence of vehicle, mock medium, or Reelin (20 nM), in the absence (basal) or presence of VEGF (100 ng/ml). Findings were replicated in three or more independent experiments.

RT-PCR analysis

RNA was isolated using RNeasy Plus Mini Kit (Qiagen), and complementary DNA (cDNA) was prepared with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The expression levels of VCAM-1 and ICAM-1 in HAECs were measured by RT-PCR on 7900HT Fast Real-time PCR System with TaqMan Universal Master Mix II (Applied Biosystems) with the following primers: ICAM1 (Hs00164932_m1), VCAM1 (Hs01003372_m1), and HPRT1 (Hs02800695_m1). HPRT expression was used as the internal standard. P- and E-selectin expression was measured with SYBR Green reagents and the following primer sets: human P-selectin (5′-TGAGCACTGCTTGAAGAAAAAGC-3′, 5′-CACGTATTCACATTCTGGCCC-3′), human E-selectin (5′-GGCAGTGGACACAGCAAATC-3′, 5′-TGGACAGCATCGCATCTCA-3′), and human acidic ribosomal phosphoprotein 36B4 (5′-GGCCTGAGCTCCCTGTCTCT-3′, 5′-GCGGTGCGTCAGGGATT-3′), which was used as the internal standard.

Statistical analyses

Statistical analyses were performed with GraphPad Prism 6.07 software using one of the following tests: two-tailed unpaired Student’s t test and one-way and two-way analysis of variance (ANOVA). All data sets were checked for normality with both the D’Agostino and Pearson omnibus and Shapiro-Wilk normality test or Kolmogorov-Smirnov normality test (when n < 7 biological replicates or independent experiments). If data were non-normal, then a nonparametric test was used to calculate significance. For nonparametric comparisons of two independent groups, a two-tailed Mann-Whitney test was used in place of the Student’s t test. For parametric comparisons of three or more groups, the one-way ANOVA with Sidak’s post hoc multiple comparisons test was used. For nonparametric comparisons of three or more groups, the Kruskal-Wallis test was performed with Dunn’s post hoc multiple comparisons test. For comparison of two or more groups with multiple treatments, the two-way ANOVA test was used with Tukey’s or Sidak’s post hoc multiple comparisons test to calculate exact multiplicity adjusted P values between groups.

SUPPLEMENTARY MATERIALS

www.sciencesignaling.org/cgi/content/full/9/419/ra29/DC1

Fig. S1. Induction of systemic Reelin deficiency in mice by tamoxifen injection and analysis of plasma lipids.

Fig. S2. Generation of mice with Reelin deficiency in the circulation using adenoviral delivery of Cre recombinase.

Fig. S3. Plasma Reelin abundance in chow-fed or high-cholesterol diet–fed mice.

Fig. S4. Effect of plasma Reelin absence on macrophage accumulation in atherosclerotic lesions in Ldlr−/− mice.

Fig. S5. Effect of Apoer2 ablation on Reelin-activated monocyte–endothelial cell adhesion.

Table S1. Detailed statistical results for all data analyzed.

Movie S1. Intravital microscopy displaying leukocyte–endothelial cell adhesion in the mesenteric microcirculation of an Ldlr−/− mouse.

Movie S2. Intravital microscopy displaying leukocyte–endothelial cell adhesion in the mesenteric microcirculation of a DKO mouse.

Movie S3. Intravital microscopy displaying leukocyte–endothelial cell adhesion in the mesenteric microcirculation of a vehicle-treated Relnfl/fl;Ldlr−/− mouse.

Movie S4. Intravital microscopy displaying leukocyte–endothelial cell adhesion in the mesenteric microcirculation of a tamoxifen-treated Relnfl/fl;Ldlr−/− mouse.

REFERENCES AND NOTES

Acknowledgments: We are indebted to R. Hewitt, H. Reyna, I. Rocha, T. Terrones, S. Turner, E. Boyle, G. Richards, N. Heard, and B. Dacus for their excellent technical assistance. We thank A. Goffinet for the G10 antibody and K. Mikoshiba for the CR50 antibody. Funding: This work was supported by NIH grants R37 HL063762 (to J.H.) and HL118001 (to P.W.S.). M.F. is a Senior Research Professor of the Hertie Foundation. J.H. was the recipient of an Alexander von Humboldt Foundation Award during the material steps of this project and was further supported by the American Health Assistance Foundation, the Consortium for Frontotemporal Dementia Research, the BrightFocus Foundation, the Lupe Murchison Foundation, and the Ted Nash Long Life Foundation. Author contributions: Y.D., L.H., X.X., and I.S.Y. performed the experiments and analyzed the data. C.R.W. analyzed the data and performed statistical analysis. M.F. contributed reagents. C.M., P.W.S., and J.H. supervised the study. P.W.S. and J.H. wrote the paper. Competing interests: Y.D., X.X., C.M., P.W.S., J.H., and the University of Texas Southwestern Medical Center have filed a provisional patent that covers the potential use of anti-Reelin strategies for the prevention of atherosclerosis. The other authors declare that they have no competing interests. Data and materials availability: The CR50 antibody requires a materials transfer agreement from RIKEN.
View Abstract

Navigate This Article