Research ArticleNeuroscience

Augmented noncanonical BMP type II receptor signaling mediates the synaptic abnormality of fragile X syndrome

See allHide authors and affiliations

Science Signaling  07 Jun 2016:
Vol. 9, Issue 431, pp. ra58
DOI: 10.1126/scisignal.aaf6060
  • Fig. 1 Different abundance of BMPR2 isoforms.

    (A) Schematic of the exon/intron structure (left) and the protein structure (right) of two isoforms of BMPR2: the FL and the CTD-truncated isoform (ΔCTD). ECD, extracellular domain; TM, transmembrane domain; aa, amino acid. (B) Immunoblot analysis and quantitative reverse transcription polymerase chain reaction (qRT-PCR) for FL and ΔCTD BMPR2 in brain, heart, liver, and kidney isolated from 12-week-old wild-type (WT) mice. Data are means ± SD of five experiments. (C) Immunoblot analysis and qRT-PCR in lysates from COS-7 cells transfected with vectors encoding FL or ΔCTD BMPR2 normalized to β-actin and GAPDH, respectively. Data are means ± SD of five experiments. **P < 0.05 by Student’s t test. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. (D) qRT-PCR analysis for BMPR2 expression in COS-7 cells transfected with vectors encoding MBP-BMPR2 [in which the BMPR2 ECD was replaced by maltose-binding protein (MBP)], FL or MBP-ΔCTD (ΔCTD) BMPR2, and treatment with actinomycin D (ActD) (5 μg/ml) 24 hours afterward for the period of time indicated. Expression was normalized to GAPDH. Data are means ± SD of five experiments. *P < 0.05 by Student’s t test. (E) Immunoblot analysis for BMPR2 in COS-7 cells transfected with optimized amount of MBP-BMPR2-FLAG (FL) or MBP-ΔCTD-FLAG (ΔCTD) expression vectors (to adjust for similar abundance of expressed protein) and treated with cycloheximide (CHX) (10 μg/ml) 48 hours afterward for the period of time indicated. Protein was normalized to β-actin. Data are means ± SD of four experiments.

  • Fig. 2 Translational regulation of BMPR2 through the mRNA sequence encoding the CTD.

    (A) Top: Schematic of the expected mRNA and protein structures of C-terminal FLAG-tagged FL, ΔCTD, and 530X BMPR2. CTDseq is the mRNA sequence encoding CTD. Bottom: Immunoblotting and qRT-PCR of FLAG or BMPR2, respectively, in transfected COS-7 cells. BMRP2 mRNA was normalized to GAPDH. Data are means ± SD of three experiments. *P < 0.05 by analysis of variance (ANOVA) with post hoc Tukey’s test. (B) Top: schematic of WT and BMPR2 ex12 deletion mutant (Δex12) allele. In the Δex12/WT mice, the ex12 of one allele of the BMPR2 gene was replaced with eGFP. Right: Immunoblot for BMPR2 abundance in two independent primary vascular smooth muscle cell cultures generated from WT (WT/WT) and heterozygous (Δex12/WT) mice. (C) Top: Schematic of WT and BMPR2 L504fs allele. A frameshift mutation was introduced in at Leu504 (ex11) of BMPR2 gene using TALEN-mediated genome editing technology (L504fs) in rat vascular smooth muscle PAC1 cells. Consequently, L504fs allele produces mutant BMPR2 lacking 504 to 1038 amino acids; however, the transcripts contain CTDseq. Right: Immunoblots for FL BMPR2 and L504fs in WT and heterozygous cells. Blots in (B) and (C) are representative of two experiments.

  • Fig. 3 FMRP binds BMPR2-CTDseq and negatively regulates translation.

    (A) RIP assay for the relative enrichment of FL BMPR2 mRNA regions [schematic (top) marked with FMRP binding regions (black or red) and corresponding primers (orange; see table S2)] in FMRP immunoprecipitates from HEK293 cells transfected with FLAG-tagged FL or ΔCTD BMPR2 constructs. Data are representative of two experiments. Pulldown with nonspecific immunoglobulin G (IgG) served as the control. nc, negative control primer; IP, immunoprecipitation. (B) RIP assay as in (A) and immunoblotting in HEK293 cells transfected with FL or mutant (Δ3240 or Δ4125) BMPR2. Data are means ± SD of three experiments. *P < 0.05; **P < 0.01 by ANOVA with post hoc Tukey’s test.

  • Fig. 4 FMR1 is a negative regulator of FL BMPR2 protein expression.

    (A) Immunoblotting and qRT-PCR for BMPR2 in COS-7 cells transfected with siRNAs against FMR1 (si-FMR1) or a control sequence (si-Ctr). Data are means ± SD of three experiments. *P < 0.01 by Student’s t test. (B) Immunoblotting and qRT-PCR for BMPR2 in stable HEK293 cell lines with doxycycline (Dox)–inducible expression of FLAG-tagged FMRP or GFP (control). Protein and mRNA abundance was normalized to GAPDH. Data are means ± SEM of three experiments. *P < 0.05 by ANOVA with post hoc Tukey’s test. (C) Immunoblotting and qRT-PCR for BMPR2 in brain lysates from P7 FMR1−/− or WT mice. Data are means ± SEM of seven individual mice. *P < 0.05 by Student’s t test. Asterisk (*) indicates a nonspecific band in the FMRP immunoblot panel. In (A) to (C), protein and mRNA abundance was normalized to GAPDH.

  • Fig. 5 Epistasis between dFMR1 and wit during the formation of NMJ in Drosophila.

    (A) Confocal images of muscle 6/7 in segment A3 from larvae of the indicated genotype. Boutons and muscle were stained with DLG antibody (green) and Alexa Fluor 568–conjugated phalloidin (red), respectively. Scale bars, 50 μm. (B) As in (A), except presynaptic and postsynaptic boutons and muscle were stained with HRP (green) and DLG (red) antibodies and Alexa Fluor 647–conjugated phalloidin (blue), respectively. Scale bars, 50 μm. (C) Bouton (left) and branch (right) numbers in muscle 6/7 in segment A3. Data are means ± SD of the following numbers of larvae: n =11 for WT, n = 27 for dFMR1D113M/+, n = 41 for witA12/+; dFMR1D113M/+, n = 10 for witA12/+, n = 10 for witA12/B11; dFMR1D113M/+, and n = 10 for witA12/B11. *P < 0.05; **P < 0.01 by ANOVA with post hoc Tukey’s test.

  • Fig. 6 BMPR2 modulates actin remodeling through activation of the LIMK1-cofilin pathway.

    (A) Alexa Fluor 568–conjugated phalloidin staining in N1E cells infected with adenovirus (Ad) expressing GFP (control), FL, or ΔCTD, and treated with BMP7 (10 ng/ml) for 24 hours. Scale bars, 40 μm. Insets are magnified ×2. Data are means ± SEM of ≥33 cells per condition. *P < 0.05, **P < 0.01 by ANOVA with post hoc Tukey’s test. A fraction of N1E cells was subjected to immunoblotting for BMPR2 (bottom left) and qRT-PCR for ID1 expression (bottom right), each was normalized to GAPDH. Data are means ± SD of three experiments. *P < 0.001 by ANOVA with post hoc Tukey’s test. (B and C) Phalloidin staining in N1E cells transfected with targeted siRNA(s) or control (si-Ctr) and treated 48 hours later with BMP7 (10 ng/ml) (B) for 24 hours or LIMKi-3 (LIMK-i; 3 μM) (C) or BMP type I receptor kinase inhibitor LDN (100 nM) for 12 hours and then BMP7 (10 ng/ml) for 24 hours. Scale bars, 50 μm. Blue arrows indicate filopodia. Phalloidin stain was blindly assessed and quantitated by ImageJ. Data are means ± SEM of ≥26 (B) or 29 (C) cells per condition. **P < 0.01 by ANOVA with post hoc Tukey’s test. ns, not significant.

  • Fig. 7 Inhibition of BMPR2-LIMK1 pathway rescues abnormal neuronal development in the mouse model of FXS.

    (A) Confocal microscopy detecting the number of dendrites (arrowheads) in neurons isolated from the cortex of FMR1−/− or littermate WT P0 mice, cultured for 3 days, and then transfected with a GFP expression plasmid and treated 24 hours later with LIMK-i (3μM) or LDN (100 nM) for 12 hours, followed by BMP7 (10 ng/ml) for 24 hours. Cells were stained and imaged at day 6 in vitro. Data are means + SEM from ≥30 GFP-positive neurons. *P < 0.01 by ANOVA with post hoc Tukey’s test. Scale bar, 30 μm. (B) Alexa Fluor 568–conjugated phalloidin staining (left) and confocal microscopy detecting spine density (right) in neurons isolated from the cortex of FMR1−/− or littermate WT P0 mice, cultured for 14 days, and then treated with LIMK-i (3μM) for 12 hours, followed by BMP7 (10 ng/ml) for 24 hours. Insets are magnified ×2. The minimum was counted. Data are means + SEM from ≥25 neurons. *P < 0.05 by ANOVA with post hoc Tukey’s test. Scale bar, 30 μm. (C) Golgi staining (left) in brain tissue isolated at P7 from FMR1−/−, FMR1−/−; BMPR2+/−, BMPR2+/−, or WT littermate mice. Dendritic spines in DG neuron were classified as either short (<2 μm) or long immature (>2 μm, red arrowheads), and the percentage of long immature spines was calculated (right). Data are means + SEM from more than seven DG neurons from three mice. *P < 0.01 by ANOVA with post hoc Tukey’s test. Scale bar, 5 μm. KO, FMR1 homozygous-null mice; Het, BMPR2 heterozygous mice. (D and E) Golgi staining (left) in brain tissue isolated at P7 from FMR1−/− or littermate WT mice treated with LIMK-i by intracerebroventricular injection at P1 and P4. Spine density was calculated as the total number of spines in a 30-μm stretch (D). The percentage of long immature spines (>2 μm) indicated by red arrowheads was calculated (E). Data are means and SEM from more than seven DG neurons from three mice. *P < 0.01 by ANOVA with post hoc Tukey’s test. Scale bars, 10 μm (D) and 5 μm (E).

  • Fig. 8 Induction of the BMPR2-LIMK1-cofilin pathway is seen in brain tissue from FXS patients.

    (A) Representative images of BMPR2 staining on the middle layer prefrontal cortex from FXS patients and control subjects (CTR) (top). Insets are magnified ×2. Average intensity of BMPR2 signals of lower, middle, or upper layer of prefrontal cortex of three FXS and three controls was quantitated (bottom). Data are means ± SD of three samples. *P < 0.01 by Student’s t test. (B) Immunoblotting in lysates from frontal cortexes from three FXS patients and three control subjects. Data are means ± SEM of three samples. **P < 0.01 by Student’s t test. P-cofilin, phosphorylated cofilin; T-cofilin, total cofilin.

  • Table 1 List of potential FMRP binding sites identified in the BMPR2 transcripts by RIP sequence.

    On the basis of a previous research (16), potential FMRP binding sites were searched in the BMPR2 transcripts. Its core sequence (WGGA or ACUK) is underlined. Location of the RIP primers and the enrichment of RNA fragments are shown. NA, not applicable.

    DomainStartEndFBM sequenceFBM
    type
    RIP
    primer
    EnrichmentT-to-C
    conversion/
    read count
    Enrichment
    ECD203329583203329597NANA0.83
    ECD203329616203329667NANA0.71
    ECD203329669203329687NANA0.22
    ECD203332327203332341NANA0.83
    TM203378479203378507NANA0.69
    KD203383687203383725ACAACAUUGCCCGCUUUAUAG
    UUGGAGAUGAGAGAGUCA
    WGGA1820No0.95No
    KD203383744203383768AAUAUUUGCUUGUGAUGGAGUACUAWGGA0.76
    KD203384831203384856AGUCUCCACACAAGUGACUGGGUAAGACUK0.36
    KD203384869203384893UGCUCAUUCUGUUACUAGAGGACUGMixed2041No0.33No
    KD203395532203395544NANA0.25
    KD203395592203395623UUAUUAGUGACUUUGGACUGU
    CCAUGAGGCUGA
    Mixed0.62
    KD203397352203397369UGUGAACUUGAGGGACUGACUK0.5
    KD203397390203397420UAGACAUGUAUGCUCUUGGACUA
    AUCUAUUG
    WGGA0.88
    KD203417463203417487AUCGAAGACUGUUGGGACCAGGAUGMixed2513No0.83No
    KD203417515203417538CUGAGGAAAGGAUGGCUGAACUUAMixed2513No0.71No
    KD203417570203417588NANA0.6
    CTD203420039203420070UACAUUGAAGACUCUAUCCAU
    CAUACUGACAG
    ACUK2736Yes0.65Yes
    CTD203420082203420103NANA0.71
    CTD203420438203420465AAUCUCAUGGAGCACUCUCUUAAACAGUWGGA3116Yes0.8Yes
    CTD203420507203420530CUUUACCCACUCAUAAAACUUGCAACUK3240Yes1Yes
    CTD203420532203420570UAGAAGCAACUGGACAGCAGG
    ACUUCACACAGACUGCAA
    Mixed3240Yes0.56Yes
    CTD203420588203420610NANA0.78
    CTD203420887203420913NANA0.38
    CTD203420939203420961UUUAUUGGUGAGGACACCCGGCUWGGA3630Yes0.63Yes
    CTD203420995203421016UUUACUGAGACGAGAGCAACAAACUK3630Yes0.67Yes
    CTD203421033203421052GUGUUCUGGAUCGUCUUGUGWGGA0.82
    CTD203421200203421222CCUAAUUCUCUGGAUCUUUCAGCWGGA0.73
    CTD203424647203424668AUAUAGGAAUGAACUGUCUGUGMixed4125Yes0.63Yes

Supplementary Materials

  • www.sciencesignaling.org/cgi/content/full/9/431/ra58/DC1

    Fig. S1. Translational regulation of BMPR2 through the mRNA sequence encoding the CTD.

    Fig. S2. FMRP binds BMPR2-CTDseq and suppresses translation.

    Fig. S3. BMP4-SMAD1/5 signaling is increased, but TGFβ-SMAD2/3 signaling is not altered in FMR1-null cells.

    Fig. S4. LIMK-i and LDN effectively inhibit LIMK1 and BMPR1 kinase activity in N1E cells.

    Fig. S5. In vivo administration of LIMK-i inhibits phosphorylation of cofilin in mouse brain.

    Table S1. qRT-PCR primers.

    Table S2. RIP PCR primers.

  • Supplementary Materials for:

    Augmented noncanonical BMP type II receptor signaling mediates the synaptic abnormality of fragile X syndrome

    Risa Kashima, Sougata Roy, Manuel Ascano, Veronica Martinez-Cerdeno, Jeanelle Ariza-Torres, Sunghwan Kim, Justin Louie, Yao Lu, Patricio Leyton, Kenneth D. Bloch, Thomas B. Kornberg, Paul J. Hagerman, Randi Hagerman, Giorgio Lagna, Akiko Hata*

    *Corresponding author. Email: akiko.hata{at}ucsf.edu

    This PDF file includes:

    • Fig. S1. Translational regulation of BMPR2 through the mRNA sequence encoding the CTD.
    • Fig. S2. FMRP binds BMPR2-CTDseq and suppresses translation.
    • Fig. S3. BMP4-SMAD1/5 signaling is increased, but TGFβ-SMAD2/3 signaling is not altered in FMR1-null cells.
    • Fig. S4. LIMK-i and LDN effectively inhibit LIMK1 and BMPR1 kinase activity in N1E cells.
    • Fig. S5. In vivo administration of LIMK-i inhibits phosphorylation of cofilin in mouse brain.
    • Table S1. qRT-PCR primers.
    • Table S2. RIP PCR primers.

    [Download PDF]

    Technical Details

    Format: Adobe Acrobat PDF

    Size: 525 KB


    Citation: R. Kashima, S. Roy, M. Ascano, V. Martinez-Cerdeno, J. Ariza-Torres, S. Kim, J. Louie, Y. Lu, P. Leyton, K. D. Bloch, T. B. Kornberg, P. J. Hagerman, R. Hagerman, G. Lagna, A. Hata, Augmented noncanonical BMP type II receptor signaling mediates the synaptic abnormality of fragile X syndrome. Sci. Signal. 9, ra58 (2016).

    © 2016 American Association for the Advancement of Science

Stay Connected to Science Signaling

Navigate This Article