Table 1 List of potential FMRP binding sites identified in the BMPR2 transcripts by RIP sequence.

On the basis of a previous research (16), potential FMRP binding sites were searched in the BMPR2 transcripts. Its core sequence (WGGA or ACUK) is underlined. Location of the RIP primers and the enrichment of RNA fragments are shown. NA, not applicable.

DomainStartEndFBM sequenceFBM
type
RIP
primer
EnrichmentT-to-C
conversion/
read count
Enrichment
ECD203329583203329597NANA0.83
ECD203329616203329667NANA0.71
ECD203329669203329687NANA0.22
ECD203332327203332341NANA0.83
TM203378479203378507NANA0.69
KD203383687203383725ACAACAUUGCCCGCUUUAUAG
UUGGAGAUGAGAGAGUCA
WGGA1820No0.95No
KD203383744203383768AAUAUUUGCUUGUGAUGGAGUACUAWGGA0.76
KD203384831203384856AGUCUCCACACAAGUGACUGGGUAAGACUK0.36
KD203384869203384893UGCUCAUUCUGUUACUAGAGGACUGMixed2041No0.33No
KD203395532203395544NANA0.25
KD203395592203395623UUAUUAGUGACUUUGGACUGU
CCAUGAGGCUGA
Mixed0.62
KD203397352203397369UGUGAACUUGAGGGACUGACUK0.5
KD203397390203397420UAGACAUGUAUGCUCUUGGACUA
AUCUAUUG
WGGA0.88
KD203417463203417487AUCGAAGACUGUUGGGACCAGGAUGMixed2513No0.83No
KD203417515203417538CUGAGGAAAGGAUGGCUGAACUUAMixed2513No0.71No
KD203417570203417588NANA0.6
CTD203420039203420070UACAUUGAAGACUCUAUCCAU
CAUACUGACAG
ACUK2736Yes0.65Yes
CTD203420082203420103NANA0.71
CTD203420438203420465AAUCUCAUGGAGCACUCUCUUAAACAGUWGGA3116Yes0.8Yes
CTD203420507203420530CUUUACCCACUCAUAAAACUUGCAACUK3240Yes1Yes
CTD203420532203420570UAGAAGCAACUGGACAGCAGG
ACUUCACACAGACUGCAA
Mixed3240Yes0.56Yes
CTD203420588203420610NANA0.78
CTD203420887203420913NANA0.38
CTD203420939203420961UUUAUUGGUGAGGACACCCGGCUWGGA3630Yes0.63Yes
CTD203420995203421016UUUACUGAGACGAGAGCAACAAACUK3630Yes0.67Yes
CTD203421033203421052GUGUUCUGGAUCGUCUUGUGWGGA0.82
CTD203421200203421222CCUAAUUCUCUGGAUCUUUCAGCWGGA0.73
CTD203424647203424668AUAUAGGAAUGAACUGUCUGUGMixed4125Yes0.63Yes