Table 5

Primers used in this study.

GeneSense primer (5′ ≥ 3′)Antisense primer (5′ ≥ 3′)Annealing temp (⁰C)
GapdhACCTTTGATGCTGGGGCTGGCGGGCTGAGTTGGGATGGGGACT58
Dnmt1GTGTGCGGGAATGTGCTCGCTCAGTGGTGGTGGCACAGCGT58
Dnmt3AAGCAAAGTGAGGACCATTACCACCATGTGTAGTGGACAGGGAAGCCA58
Tet1GCCAACCAGGAAGAGGCGACTGGAGGAAGCCTGCAGGGGACAG58
Kcnn1AGGTGAATGATCAGGCCAACAGCTATGAGACTTGGTAGGGCC60
Kcnn3CACCAACTGAGGGGTGTCAAGGCTGCCAATCTGCTTTTCC60